Incidental Mutation 'R2364:Zfp143'
ID247273
Institutional Source Beutler Lab
Gene Symbol Zfp143
Ensembl Gene ENSMUSG00000061079
Gene Namezinc finger protein 143
SynonymsD7Ertd805e, KRAB14, pHZ-1, Staf, Zfp79, Zfp80-rs1
MMRRC Submission 040345-MU
Accession Numbers

NCBI RefSeq: NM_009281.3; MGI:1277969

Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location110061217-110095394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110083242 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 339 (T339K)
Ref Sequence ENSEMBL: ENSMUSP00000148235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084727] [ENSMUST00000169638] [ENSMUST00000209505] [ENSMUST00000211798]
Predicted Effect probably benign
Transcript: ENSMUST00000084727
AA Change: T340K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000081778
Gene: ENSMUSG00000061079
AA Change: T340K

DomainStartEndE-ValueType
ZnF_C2H2 236 260 5.5e-3 SMART
ZnF_C2H2 266 290 6.42e-4 SMART
ZnF_C2H2 296 320 4.01e-5 SMART
ZnF_C2H2 326 350 1.38e-3 SMART
ZnF_C2H2 356 380 3.95e-4 SMART
ZnF_C2H2 386 410 2.4e-3 SMART
ZnF_C2H2 416 439 1.79e-2 SMART
low complexity region 443 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169638
AA Change: T312K

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126015
Gene: ENSMUSG00000061079
AA Change: T312K

DomainStartEndE-ValueType
ZnF_C2H2 209 233 5.5e-3 SMART
ZnF_C2H2 239 263 6.42e-4 SMART
ZnF_C2H2 269 293 4.01e-5 SMART
ZnF_C2H2 299 323 1.38e-3 SMART
ZnF_C2H2 329 353 3.95e-4 SMART
ZnF_C2H2 359 383 2.4e-3 SMART
ZnF_C2H2 389 412 1.79e-2 SMART
low complexity region 416 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect probably damaging
Transcript: ENSMUST00000209505
AA Change: T339K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000211798
AA Change: T339K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 2678408
PHENOTYPE: Homozygous disruption of this locus results in fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(2) Gene trapped(84)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Zfp143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp143 APN 7 110091772 missense probably damaging 0.99
IGL01610:Zfp143 APN 7 110074126 nonsense probably null
IGL01678:Zfp143 APN 7 110080351 splice site probably benign
IGL01734:Zfp143 APN 7 110072209 splice site probably benign
IGL02505:Zfp143 APN 7 110091786 missense possibly damaging 0.54
IGL02577:Zfp143 APN 7 110091907 missense probably damaging 1.00
IGL03084:Zfp143 APN 7 110069611 splice site probably benign
H8786:Zfp143 UTSW 7 110094368 missense probably damaging 1.00
P0015:Zfp143 UTSW 7 110086111 critical splice acceptor site probably null
R0324:Zfp143 UTSW 7 110077147 missense possibly damaging 0.94
R0445:Zfp143 UTSW 7 110061117 unclassified probably benign
R0668:Zfp143 UTSW 7 110061274 unclassified probably benign
R1178:Zfp143 UTSW 7 110075721 splice site probably benign
R1587:Zfp143 UTSW 7 110074068 missense probably benign 0.06
R1992:Zfp143 UTSW 7 110061282 unclassified probably benign
R2110:Zfp143 UTSW 7 110086246 missense probably damaging 1.00
R2417:Zfp143 UTSW 7 110069596 missense possibly damaging 0.73
R2899:Zfp143 UTSW 7 110072129 missense probably damaging 1.00
R3923:Zfp143 UTSW 7 110074191 missense probably damaging 1.00
R4117:Zfp143 UTSW 7 110091913 missense probably damaging 0.97
R4804:Zfp143 UTSW 7 110088769 missense probably damaging 1.00
R5048:Zfp143 UTSW 7 110074118 missense probably damaging 0.99
R5097:Zfp143 UTSW 7 110088791 missense probably damaging 1.00
R5239:Zfp143 UTSW 7 110094352 missense probably damaging 1.00
R5541:Zfp143 UTSW 7 110070480 missense probably benign 0.02
R5543:Zfp143 UTSW 7 110083315 nonsense probably null
R5630:Zfp143 UTSW 7 110088773 missense probably damaging 1.00
R5806:Zfp143 UTSW 7 110086235 nonsense probably null
R6334:Zfp143 UTSW 7 110086131 missense probably damaging 1.00
R6736:Zfp143 UTSW 7 110091814 missense probably damaging 1.00
R7201:Zfp143 UTSW 7 110093080 missense possibly damaging 0.74
R7448:Zfp143 UTSW 7 110070498 missense probably benign 0.00
R7635:Zfp143 UTSW 7 110088818 missense probably benign 0.37
R7717:Zfp143 UTSW 7 110086220 missense possibly damaging 0.93
R7943:Zfp143 UTSW 7 110072474 splice site probably null
R8191:Zfp143 UTSW 7 110077157 missense probably damaging 1.00
R8268:Zfp143 UTSW 7 110091784 missense probably benign 0.27
R8368:Zfp143 UTSW 7 110083248 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTCTCTCCAGAACACAGC -3'
(R):5'- AGTTGAAAGCCTCGAAGGAC -3'

Sequencing Primer
(F):5'- CTTAGAAGGGAAACTCAGGGCCTTC -3'
(R):5'- TTGAAAGCCTCGAAGGACACAGG -3'
Posted On2014-10-30