Incidental Mutation 'R2364:Zfp317'
ID247276
Institutional Source Beutler Lab
Gene Symbol Zfp317
Ensembl Gene ENSMUSG00000057551
Gene Namezinc finger protein 317
SynonymsZfp67, KRAB9, Zfp75, D230022C05Rik
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19622102-19649731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19647735 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 415 (D415G)
Ref Sequence ENSEMBL: ENSMUSP00000151161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079042] [ENSMUST00000208694] [ENSMUST00000213725] [ENSMUST00000215372]
Predicted Effect probably benign
Transcript: ENSMUST00000079042
AA Change: D504G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078051
Gene: ENSMUSG00000057551
AA Change: D504G

DomainStartEndE-ValueType
KRAB 60 120 4.58e-32 SMART
ZnF_C2H2 223 245 1.79e-2 SMART
ZnF_C2H2 251 273 6.88e-4 SMART
ZnF_C2H2 279 301 2.24e-3 SMART
ZnF_C2H2 307 329 1.1e-2 SMART
ZnF_C2H2 335 357 7.37e-4 SMART
ZnF_C2H2 363 385 8.47e-4 SMART
ZnF_C2H2 391 413 1.3e-4 SMART
ZnF_C2H2 419 441 3.63e-3 SMART
ZnF_C2H2 447 469 3.34e-2 SMART
ZnF_C2H2 475 497 4.47e-3 SMART
ZnF_C2H2 503 525 9.73e-4 SMART
ZnF_C2H2 531 553 5.9e-3 SMART
ZnF_C2H2 559 581 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208694
AA Change: D504G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000213725
AA Change: D415G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215372
AA Change: D504G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Zfp317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02425:Zfp317 APN 9 19643613 nonsense probably null
R1520:Zfp317 UTSW 9 19647848 missense possibly damaging 0.95
R1646:Zfp317 UTSW 9 19647312 missense probably damaging 1.00
R1860:Zfp317 UTSW 9 19641984 missense possibly damaging 0.85
R2029:Zfp317 UTSW 9 19645236 missense probably benign 0.13
R4006:Zfp317 UTSW 9 19648037 missense possibly damaging 0.82
R4031:Zfp317 UTSW 9 19646712 missense possibly damaging 0.53
R4293:Zfp317 UTSW 9 19646694 splice site probably null
R4897:Zfp317 UTSW 9 19646847 missense probably benign 0.28
R5593:Zfp317 UTSW 9 19647288 missense probably damaging 1.00
R6077:Zfp317 UTSW 9 19646888 missense probably benign 0.00
R6573:Zfp317 UTSW 9 19645254 missense probably damaging 0.99
R6652:Zfp317 UTSW 9 19647039 missense probably damaging 1.00
R6750:Zfp317 UTSW 9 19647804 missense probably damaging 1.00
R6875:Zfp317 UTSW 9 19643665 missense probably damaging 0.98
R7688:Zfp317 UTSW 9 19647955 missense probably damaging 1.00
R8054:Zfp317 UTSW 9 19641969 missense probably benign 0.00
Z1177:Zfp317 UTSW 9 19647030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGATCTCTGCGGCAAAG -3'
(R):5'- GTGGGTTTTCACATGACTCCTAAG -3'

Sequencing Primer
(F):5'- GGCAAAGCCTTCAGTGCTAGTTC -3'
(R):5'- GTTTTCACATGACTCCTAAGGGACG -3'
Posted On2014-10-30