Incidental Mutation 'R2364:Zfp651'
ID247277
Institutional Source Beutler Lab
Gene Symbol Zfp651
Ensembl Gene ENSMUSG00000013419
Gene Namezinc finger protein 651
Synonyms4732420M22Rik
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R2364 (G1)
Quality Score202
Status Not validated
Chromosome9
Chromosomal Location121759330-121771742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121767594 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 672 (P672L)
Ref Sequence ENSEMBL: ENSMUSP00000091286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093772]
Predicted Effect probably damaging
Transcript: ENSMUST00000093772
AA Change: P672L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091286
Gene: ENSMUSG00000013419
AA Change: P672L

DomainStartEndE-ValueType
BTB 45 141 3.69e-19 SMART
low complexity region 159 164 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 217 231 N/A INTRINSIC
low complexity region 302 339 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
ZnF_C2H2 447 470 1.28e-3 SMART
ZnF_C2H2 474 494 8.4e1 SMART
ZnF_C2H2 501 524 1.76e-1 SMART
ZnF_C2H2 531 553 3.34e-2 SMART
ZnF_C2H2 559 581 6.78e-3 SMART
ZnF_C2H2 587 609 3.63e-3 SMART
ZnF_C2H2 615 637 1.95e-3 SMART
ZnF_C2H2 643 665 6.62e-6 SMART
ZnF_C2H2 671 698 4.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213743
Predicted Effect probably benign
Transcript: ENSMUST00000214732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215081
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Other mutations in Zfp651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Zfp651 APN 9 121763969 missense probably damaging 1.00
R0193:Zfp651 UTSW 9 121767666 missense probably damaging 0.98
R0270:Zfp651 UTSW 9 121767575 missense probably benign 0.27
R0347:Zfp651 UTSW 9 121763102 missense probably damaging 1.00
R0654:Zfp651 UTSW 9 121763261 missense probably benign 0.01
R2202:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2203:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2204:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2205:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R3843:Zfp651 UTSW 9 121763433 missense possibly damaging 0.86
R4275:Zfp651 UTSW 9 121766539 missense probably damaging 1.00
R4934:Zfp651 UTSW 9 121763979 missense probably damaging 0.99
R5358:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R5462:Zfp651 UTSW 9 121767663 missense probably damaging 0.99
R5613:Zfp651 UTSW 9 121767519 missense probably damaging 1.00
R5843:Zfp651 UTSW 9 121767339 missense possibly damaging 0.47
R5863:Zfp651 UTSW 9 121767530 missense probably benign 0.22
R6009:Zfp651 UTSW 9 121762871 missense possibly damaging 0.86
R6063:Zfp651 UTSW 9 121763532 missense probably benign 0.01
R6114:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R6223:Zfp651 UTSW 9 121763787 missense possibly damaging 0.61
R6414:Zfp651 UTSW 9 121763659 missense probably benign
R6811:Zfp651 UTSW 9 121766529 missense probably damaging 1.00
R7394:Zfp651 UTSW 9 121767345 missense probably damaging 0.98
R7430:Zfp651 UTSW 9 121763666 missense probably benign 0.02
R8215:Zfp651 UTSW 9 121767278 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTTTGACGAGCACATGAAGAC -3'
(R):5'- TCAGTTAGTGTCCAGCCTGG -3'

Sequencing Primer
(F):5'- ACACAGGTGCGTGCCTTAC -3'
(R):5'- TGTCCAGCCTGGGAGGTG -3'
Posted On2014-10-30