Incidental Mutation 'R2364:Os9'
ID247278
Institutional Source Beutler Lab
Gene Symbol Os9
Ensembl Gene ENSMUSG00000040462
Gene Nameamplified in osteosarcoma
Synonyms4632413K17Rik
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127095650-127121131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127119138 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 180 (K180N)
Ref Sequence ENSEMBL: ENSMUSP00000128914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080975] [ENSMUST00000164259] [ENSMUST00000218798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080975
AA Change: K180N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079770
Gene: ENSMUSG00000040462
AA Change: K180N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 2.3e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 533 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164259
AA Change: K180N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128914
Gene: ENSMUSG00000040462
AA Change: K180N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 8.6e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218798
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly expressed in osteosarcomas. This protein binds to the hypoxia-inducible factor 1 (HIF-1), a key regulator of the hypoxic response and angiogenesis, and promotes the degradation of one of its subunits. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Os9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Os9 APN 10 127097976 missense probably benign
IGL00978:Os9 APN 10 127120509 missense probably damaging 1.00
IGL01683:Os9 APN 10 127100103 missense probably damaging 1.00
IGL01862:Os9 APN 10 127099704 missense probably benign 0.00
IGL01997:Os9 APN 10 127119443 missense probably benign 0.00
IGL02035:Os9 APN 10 127096291 missense possibly damaging 0.60
IGL02039:Os9 APN 10 127096291 missense possibly damaging 0.60
IGL02134:Os9 APN 10 127120992 missense possibly damaging 0.91
IGL02851:Os9 APN 10 127099393 intron probably benign
IGL03169:Os9 APN 10 127098594 missense probably benign 0.08
R0211:Os9 UTSW 10 127121036 missense probably damaging 0.97
R0514:Os9 UTSW 10 127119639 missense probably damaging 1.00
R0619:Os9 UTSW 10 127120991 missense probably damaging 1.00
R0930:Os9 UTSW 10 127097055 missense probably damaging 1.00
R1532:Os9 UTSW 10 127098902 missense probably damaging 1.00
R4600:Os9 UTSW 10 127098354 missense probably benign 0.06
R4982:Os9 UTSW 10 127121051 missense possibly damaging 0.92
R5850:Os9 UTSW 10 127098479 utr 3 prime probably benign
R6148:Os9 UTSW 10 127099943 missense probably benign 0.05
R6257:Os9 UTSW 10 127119137 missense probably damaging 1.00
R6650:Os9 UTSW 10 127100084 critical splice donor site probably null
R6731:Os9 UTSW 10 127098543 missense probably benign
R7090:Os9 UTSW 10 127099678 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTGAGGGTAGCCTGTGGTAAAC -3'
(R):5'- GTCACATTGAGCTGGTGTGC -3'

Sequencing Primer
(F):5'- TGTGGTAAACGAAGAGTTAAATTACC -3'
(R):5'- CATTGAGCTGGTGTGCCTCTTG -3'
Posted On2014-10-30