Incidental Mutation 'R0288:Adgrg3'
ID24728
Institutional Source Beutler Lab
Gene Symbol Adgrg3
Ensembl Gene ENSMUSG00000060470
Gene Nameadhesion G protein-coupled receptor G3
SynonymsGpr97, Pb99, A030001G24Rik
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95017692-95045250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95039940 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 413 (E413G)
Ref Sequence ENSEMBL: ENSMUSP00000051079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051259
AA Change: E413G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051079
Gene: ENSMUSG00000060470
AA Change: E413G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 209 256 3.45e-11 SMART
Pfam:7tm_2 260 509 5.1e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211994
Predicted Effect probably benign
Transcript: ENSMUST00000212570
Meta Mutation Damage Score 0.2357 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Adgrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Adgrg3 APN 8 95039593 missense possibly damaging 0.90
IGL01724:Adgrg3 APN 8 95039425 missense probably benign 0.04
IGL02111:Adgrg3 APN 8 95034999 missense probably damaging 0.96
IGL02142:Adgrg3 APN 8 95039855 missense probably damaging 1.00
IGL02577:Adgrg3 APN 8 95039927 missense probably damaging 0.99
IGL02940:Adgrg3 APN 8 95033456 missense possibly damaging 0.48
IGL03395:Adgrg3 APN 8 95035073 missense probably damaging 1.00
R0111:Adgrg3 UTSW 8 95035110 splice site probably benign
R0403:Adgrg3 UTSW 8 95036922 missense probably benign 0.07
R1553:Adgrg3 UTSW 8 95040268 missense possibly damaging 0.90
R1667:Adgrg3 UTSW 8 95033373 nonsense probably null
R1686:Adgrg3 UTSW 8 95033369 missense probably benign 0.02
R1872:Adgrg3 UTSW 8 95033442 missense possibly damaging 0.87
R1882:Adgrg3 UTSW 8 95040315 missense probably benign 0.03
R1924:Adgrg3 UTSW 8 95035934 missense probably benign
R1998:Adgrg3 UTSW 8 95036668 missense probably damaging 1.00
R2090:Adgrg3 UTSW 8 95039930 missense possibly damaging 0.54
R2696:Adgrg3 UTSW 8 95021074 missense probably benign 0.01
R3846:Adgrg3 UTSW 8 95040421 missense probably benign 0.07
R4013:Adgrg3 UTSW 8 95035099 splice site probably benign
R4405:Adgrg3 UTSW 8 95036908 missense probably benign 0.15
R4622:Adgrg3 UTSW 8 95040525 missense probably damaging 1.00
R4878:Adgrg3 UTSW 8 95035086 missense possibly damaging 0.86
R5101:Adgrg3 UTSW 8 95036935 missense probably benign 0.00
R5309:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5312:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5353:Adgrg3 UTSW 8 95035928 missense probably damaging 0.99
R5820:Adgrg3 UTSW 8 95039593 missense possibly damaging 0.90
R6240:Adgrg3 UTSW 8 95039916 missense probably benign 0.23
R6272:Adgrg3 UTSW 8 95036261 missense noncoding transcript
R7110:Adgrg3 UTSW 8 95034963 missense possibly damaging 0.62
R7645:Adgrg3 UTSW 8 95034764 intron probably benign
X0017:Adgrg3 UTSW 8 95017770 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- TTTCCTGAAGCTGAGCCTGCTG -3'
(R):5'- TCTGTAGTGACCAAGACGATGCCC -3'

Sequencing Primer
(F):5'- CTAGGGAAGCCCAAAGCTC -3'
(R):5'- ACCCCCCATTGCTGTTGG -3'
Posted On2013-04-16