Incidental Mutation 'R2364:Adam6a'
ID247282
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Namea disintegrin and metallopeptidase domain 6A
SynonymsAdam6
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113543908-113546465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113544630 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 208 (K208E)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
Predicted Effect probably benign
Transcript: ENSMUST00000053086
AA Change: K208E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: K208E

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8356:Adam6a UTSW 12 113546137 missense probably benign 0.08
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCTGTCAGGGGTCATAAAG -3'
(R):5'- CAGCCTCGGTATACACAGTCATG -3'

Sequencing Primer
(F):5'- GGGTCATAAAGTTGGATAACCTTACC -3'
(R):5'- CCTCGGTATACACAGTCATGAGAAAG -3'
Posted On2014-10-30