Incidental Mutation 'R2364:Olfr731'
ID247284
Institutional Source Beutler Lab
Gene Symbol Olfr731
Ensembl Gene ENSMUSG00000048080
Gene Nameolfactory receptor 731
SynonymsMOR246-5, GA_x6K02T2PMLR-5936117-5935137
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50233531-50241866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50238155 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 243 (H243Q)
Ref Sequence ENSEMBL: ENSMUSP00000150683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059565] [ENSMUST00000214152] [ENSMUST00000214388]
Predicted Effect probably damaging
Transcript: ENSMUST00000059565
AA Change: H243Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050705
Gene: ENSMUSG00000048080
AA Change: H243Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 8.5e-51 PFAM
Pfam:7tm_1 41 287 5.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213322
Predicted Effect probably damaging
Transcript: ENSMUST00000214152
AA Change: H243Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214388
AA Change: H243Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Olfr731
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Olfr731 APN 14 50238138 missense possibly damaging 0.87
IGL02304:Olfr731 APN 14 50238760 missense probably damaging 1.00
IGL02395:Olfr731 APN 14 50238429 missense probably damaging 1.00
IGL03079:Olfr731 APN 14 50238124 missense possibly damaging 0.81
R0646:Olfr731 UTSW 14 50238639 missense probably damaging 1.00
R1253:Olfr731 UTSW 14 50238124 missense probably damaging 1.00
R2027:Olfr731 UTSW 14 50237949 missense probably benign
R4714:Olfr731 UTSW 14 50238367 missense possibly damaging 0.68
R4749:Olfr731 UTSW 14 50238733 missense probably damaging 0.96
R5880:Olfr731 UTSW 14 50238715 missense possibly damaging 0.95
R6954:Olfr731 UTSW 14 50238110 nonsense probably null
R7295:Olfr731 UTSW 14 50238616 missense probably damaging 0.98
R7419:Olfr731 UTSW 14 50237991 missense possibly damaging 0.85
R7457:Olfr731 UTSW 14 50238368 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCAGTCCTTTCACTGTATAATG -3'
(R):5'- CCCTTCTGTGGTCCAAATGTG -3'

Sequencing Primer
(F):5'- TGGTTACTTATTTTCTTCTTCACTGC -3'
(R):5'- GTCCAAATGTGGTAGACAGTTTC -3'
Posted On2014-10-30