Incidental Mutation 'R2364:Dnajc28'
ID247286
Institutional Source Beutler Lab
Gene Symbol Dnajc28
Ensembl Gene ENSMUSG00000039763
Gene NameDnaJ heat shock protein family (Hsp40) member C28
SynonymsORF28
MMRRC Submission 040345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2364 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91614254-91619026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91616867 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 187 (T187M)
Ref Sequence ENSEMBL: ENSMUSP00000132288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000049244] [ENSMUST00000133731] [ENSMUST00000143058] [ENSMUST00000156713] [ENSMUST00000169982] [ENSMUST00000232289] [ENSMUST00000232640]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049244
AA Change: T163M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048113
Gene: ENSMUSG00000039763
AA Change: T163M

DomainStartEndE-ValueType
DnaJ 47 105 1.04e-11 SMART
low complexity region 112 123 N/A INTRINSIC
Pfam:DUF1992 203 342 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133731
SMART Domains Protein: ENSMUSP00000118526
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 84 6.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect possibly damaging
Transcript: ENSMUST00000143058
AA Change: T187M

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120318
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169982
AA Change: T187M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132288
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Pfam:DUF1992 227 295 1.2e-24 PFAM
coiled coil region 312 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232620
Predicted Effect probably benign
Transcript: ENSMUST00000232640
Predicted Effect probably benign
Transcript: ENSMUST00000232643
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DnaJ heat shock protein family. The encoded protein, which contains a conserved N-terminal DnaJ domain, is thought to play a role in protein folding or act as a molecular chaperone protein. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik A G 3: 138,165,823 S268P probably benign Het
Adam6a A G 12: 113,544,630 K208E probably benign Het
Anks6 A G 4: 47,027,248 S725P possibly damaging Het
Asb3 A G 11: 31,101,192 I549V probably benign Het
Blvrb A G 7: 27,448,133 I6V possibly damaging Het
Cabs1 A T 5: 87,980,233 T248S probably benign Het
Cdk5rap2 A G 4: 70,360,809 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Fpr1 A T 17: 17,877,610 L39* probably null Het
Gstm5 A G 3: 107,896,371 E40G probably benign Het
Hnrnpr A G 4: 136,327,329 M97V possibly damaging Het
Hs6st1 T C 1: 36,068,719 V21A probably benign Het
Hsp90aa1 A T 12: 110,692,753 F537I probably damaging Het
Insr T C 8: 3,174,820 D216G probably benign Het
Kif2a A T 13: 106,976,836 N428K probably damaging Het
Mapk10 G T 5: 103,038,641 N38K possibly damaging Het
Myh8 A G 11: 67,294,518 E865G probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr1457 A G 19: 13,094,754 V298A probably damaging Het
Olfr357 T C 2: 36,997,565 Y252H probably damaging Het
Olfr731 A T 14: 50,238,155 H243Q probably damaging Het
Os9 T A 10: 127,119,138 K180N possibly damaging Het
Pcdhb20 A T 18: 37,505,938 I506F probably damaging Het
Pros1 T G 16: 62,913,848 L339R probably damaging Het
Srp72 A G 5: 76,984,362 I266V probably benign Het
Tmem245 A G 4: 56,899,391 V632A probably damaging Het
Tpcn1 G T 5: 120,553,494 C298* probably null Het
Ubfd1 T A 7: 122,068,944 D232E probably benign Het
Vamp1 A T 6: 125,240,343 I117L probably benign Het
Wwtr1 T C 3: 57,462,603 T364A possibly damaging Het
Zfp143 C A 7: 110,083,242 T339K probably damaging Het
Zfp317 A G 9: 19,647,735 D415G probably benign Het
Zfp628 A G 7: 4,920,687 H636R probably damaging Het
Zfp651 C T 9: 121,767,594 P672L probably damaging Het
Other mutations in Dnajc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Dnajc28 APN 16 91616441 missense possibly damaging 0.49
R1199:Dnajc28 UTSW 16 91618642 unclassified probably benign
R2265:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2266:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2276:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2277:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2278:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2366:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2367:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2447:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3757:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3890:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4087:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4088:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4110:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4112:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4113:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R6372:Dnajc28 UTSW 16 91617288 missense probably benign 0.36
R6613:Dnajc28 UTSW 16 91616358 nonsense probably null
R8061:Dnajc28 UTSW 16 91617170 missense possibly damaging 0.70
R8163:Dnajc28 UTSW 16 91616907 nonsense probably null
R8165:Dnajc28 UTSW 16 91616907 nonsense probably null
R8172:Dnajc28 UTSW 16 91616907 nonsense probably null
R8174:Dnajc28 UTSW 16 91616907 nonsense probably null
Z1176:Dnajc28 UTSW 16 91617033 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGCCAGAAAATTTCTTCAGCGG -3'
(R):5'- TGTCCCATGCGATAAAACGG -3'

Sequencing Primer
(F):5'- TTTCCCGCTGAGATTGTCAAAG -3'
(R):5'- TGCGATAAAACGGATGCATGCC -3'
Posted On2014-10-30