Mutagenetix > Incidental Mutations

Incidental Mutation 'R1458:Cic'

247290

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

039513-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.925) question?

Stock #

R1458 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 25279737 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]

Predicted Effect

probably benign
Transcript: ENSMUST00000005578

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163320

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164440

Predicted Effect

probably benign
Transcript: ENSMUST00000165239

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

probably benign
Transcript: ENSMUST00000169266

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169743

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.8%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700036A12Rik	A	G	9: 60,769,761		noncoding transcript	Het
A430110L20Rik	T	A	1: 181,227,858		noncoding transcript	Het
Abce1	T	C	8: 79,707,235	K63R	possibly damaging	Het
Acp6	A	G	3: 97,173,788		probably benign	Het
Adamts13	T	A	2: 26,988,354	L579Q	probably damaging	Het
Adamtsl3	T	A	7: 82,523,320	M497K	probably damaging	Het
Adgrb2	T	A	4: 130,014,591	M1042K	possibly damaging	Het
Akap12	A	T	10: 4,353,693	S168C	probably damaging	Het
Akap3	A	T	6: 126,865,554	M379L	probably damaging	Het
Aldh6a1	C	T	12: 84,439,663	M135I	probably null	Het
Arhgef12	A	G	9: 42,988,998	S860P	probably damaging	Het
Atp11b	A	C	3: 35,789,558	T185P	probably damaging	Het
Bcas1	T	C	2: 170,387,951	D243G	probably damaging	Het
Cdhr2	T	A	13: 54,717,872	S228T	probably damaging	Het
Cmya5	T	A	13: 93,065,327	I3376L	probably benign	Het
Ctrc	C	A	4: 141,846,224		probably null	Het
D230025D16Rik	T	C	8: 105,246,556		probably null	Het
Dchs1	G	T	7: 105,755,244	P2697Q	probably damaging	Het
Dmbt1	A	G	7: 131,044,487		probably benign	Het
Drd2	G	A	9: 49,402,212	R227H	probably damaging	Het
Dscc1	C	A	15: 55,086,764	C195F	probably damaging	Het
Dzip1	T	A	14: 118,922,713	M28L	probably benign	Het
Edar	A	T	10: 58,607,366	S313T	probably benign	Het
Eef1e1	C	A	13: 38,656,123	A69S	probably damaging	Het
Fbn1	A	G	2: 125,301,929	V2760A	probably benign	Het
Fez1	GACAAACA	GACA	9: 36,870,549		probably null	Het
Fgl1	C	G	8: 41,210,459	A11P	possibly damaging	Het
Fras1	T	C	5: 96,600,733	V689A	probably benign	Het
Fry	T	A	5: 150,380,859	D571E	probably damaging	Het
Gm11232	T	A	4: 71,757,213	R104*	probably null	Het
Gm1527	A	G	3: 28,918,050	I439V	possibly damaging	Het
Gm4922	C	A	10: 18,783,892	G361*	probably null	Het
Gm7052	T	A	17: 22,040,466		probably benign	Het
Gm7534	T	C	4: 134,196,833	D467G	probably benign	Het
Gpatch8	A	T	11: 102,481,229	S494R	unknown	Het
Gria2	A	T	3: 80,732,045	V220E	possibly damaging	Het
Grik4	G	A	9: 42,521,122	H860Y	probably benign	Het
Gtpbp1	A	C	15: 79,707,729	S93R	probably damaging	Het
Gucy2g	C	A	19: 55,215,036		probably benign	Het
Hist1h2ae	C	A	13: 23,571,047		probably benign	Het
Hmcn1	G	A	1: 150,609,700	R4384C	probably damaging	Het
Hspa12b	G	C	2: 131,145,192	A678P	probably damaging	Het
Igsf21	T	A	4: 140,028,124	N407Y	probably damaging	Het
Insig2	A	G	1: 121,307,156	Y174H	probably benign	Het
Itpr3	T	A	17: 27,118,372	M2413K	probably benign	Het
Kalrn	A	T	16: 34,174,487	I1322N	probably damaging	Het
Klk1b24	T	A	7: 44,191,466	M106K	possibly damaging	Het
Krt81	G	T	15: 101,460,317	Q352K	probably benign	Het
Lca5l	A	T	16: 96,159,859	S468T	possibly damaging	Het
Lvrn	T	C	18: 46,882,385		probably benign	Het
Mcpt1	T	A	14: 56,019,164		probably benign	Het
Med13l	T	C	5: 118,738,459	M900T	probably benign	Het
Med16	A	G	10: 79,907,478		probably benign	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mep1a	T	C	17: 43,491,672	H154R	probably damaging	Het
Mrc2	A	T	11: 105,337,772	D659V	probably benign	Het
Mroh8	T	A	2: 157,221,304	E799V	probably damaging	Het
Mrpl21	A	G	19: 3,284,808	Y50C	possibly damaging	Het
Msl1	A	G	11: 98,803,982		probably benign	Het
Myo1a	C	A	10: 127,719,937	Q932K	probably benign	Het
Nav3	A	C	10: 109,720,044	S1675R	probably damaging	Het
Neurl2	A	G	2: 164,832,746	V232A	possibly damaging	Het
Nfatc1	T	A	18: 80,665,267		probably benign	Het
Odf3l2	A	T	10: 79,645,558		probably benign	Het
Olfr1362	C	T	13: 21,611,822	C49Y	probably benign	Het
Olfr175-ps1	T	A	16: 58,824,676	E11V	probably null	Het
P4hb	A	G	11: 120,562,555		probably benign	Het
Papss1	T	G	3: 131,605,854	I281S	probably damaging	Het
Pde10a	A	T	17: 8,964,708	D832V	probably damaging	Het
Pfkfb2	A	T	1: 130,708,190	Y35N	possibly damaging	Het
Phf20l1	T	A	15: 66,604,813	F253Y	probably damaging	Het
Pkhd1l1	G	A	15: 44,516,115	V1046I	probably benign	Het
Plin3	C	T	17: 56,284,337	A148T	probably benign	Het
Ppp1r8	T	C	4: 132,840,631		probably benign	Het
Ppp2r3a	A	G	9: 101,211,312	L604P	probably damaging	Het
Prdm5	T	C	6: 65,883,601	V239A	probably damaging	Het
Prickle1	A	G	15: 93,500,638	S770P	probably damaging	Het
Prl2c5	T	A	13: 13,190,725	I155N	probably benign	Het
Prom1	T	C	5: 44,032,932		probably benign	Het
Psg25	C	T	7: 18,529,587	G104R	probably damaging	Het
Rbm19	T	C	5: 120,144,029	V817A	probably benign	Het
Ryr2	T	A	13: 11,727,022	Y2091F	probably damaging	Het
Slc16a4	A	G	3: 107,300,932	T253A	probably benign	Het
Smg7	A	T	1: 152,855,843		probably null	Het
Spink5	C	A	18: 44,007,719	H662N	probably benign	Het
Taf2	A	T	15: 55,059,915	M322K	probably damaging	Het
Tmc2	T	C	2: 130,248,762	F676S	probably damaging	Het
Tmem177	A	G	1: 119,910,185	S255P	possibly damaging	Het
Trim46	A	T	3: 89,235,068		probably null	Het
Tubb1	T	A	2: 174,450,803		probably null	Het
Upf1	T	C	8: 70,344,254	T110A	probably benign	Het
Vmn2r9	T	A	5: 108,848,984	I140L	probably benign	Het
Zfp638	T	A	6: 83,944,656	H588Q	probably damaging	Het
Zfp780b	T	A	7: 27,964,827	N101I	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
R7841:Cic	UTSW	7	25285767	missense	probably damaging	1.00
R7879:Cic	UTSW	7	25285126	missense	probably benign	0.10
R7924:Cic	UTSW	7	25285767	missense	probably damaging	1.00
R7962:Cic	UTSW	7	25285126	missense	probably benign	0.10
V7732:Cic	UTSW	7	25292245	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCGGCTAGTGGAAAATCTCGTG -3'
(R):5'- GCTTTAGCCCAAAACTAAGTAGCTCCC -3'

Sequencing Primer
(F):5'- TAGCTTGGCGCACACTGAC -3'
(R):5'- CTAAGTAGCTCCCAACAAAACAC -3'

Posted On

2014-10-30