Mutagenetix > Incidental Mutation

Incidental Mutation 'R1342:Hjurp'

247300

Institutional Source

Beutler Lab

Gene Symbol

Hjurp

Ensembl Gene

ENSMUSG00000044783

Gene Name

Holliday junction recognition protein

Synonyms

MMRRC Submission

039407-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R1342 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88262471-88277633 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 88277368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000065420] [ENSMUST00000147393]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000054674

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000065420

SMART Domains

Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	2.9e-11	PFAM
low complexity region	83	99	N/A	INTRINSIC
low complexity region	139	156	N/A	INTRINSIC
Pfam:HJURP_mid	178	295	7.4e-64	PFAM
Pfam:HJURP_C	309	371	1.2e-26	PFAM
low complexity region	420	439	N/A	INTRINSIC
Pfam:HJURP_C	451	510	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126739

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128532

Predicted Effect

probably benign
Transcript: ENSMUST00000147393

SMART Domains

Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	9	70	7.2e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148138

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.8%
20x: 91.6%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp10a	G	T	7: 58,816,146		probably benign	Het
B3gnt9	T	C	8: 105,254,324	E144G	probably null	Het
Bcl9	G	T	3: 97,205,726	Q1138K	possibly damaging	Het
C6	T	C	15: 4,739,749		probably benign	Het
Ccl4	A	G	11: 83,663,576		probably benign	Het
Cdc73	A	G	1: 143,702,492		probably null	Het
Cemip	A	T	7: 83,944,075	L1140*	probably null	Het
Chd4	C	A	6: 125,097,188	P8Q	probably benign	Het
Col27a1	G	A	4: 63,257,114		probably null	Het
Col9a1	G	A	1: 24,223,620		probably null	Het
Colgalt1	C	T	8: 71,618,160	T232I	probably damaging	Het
Dnah8	A	G	17: 30,721,000	D1640G	probably damaging	Het
Dot1l	T	G	10: 80,786,025	C504G	probably benign	Het
Gm9892	T	C	8: 52,196,423	T212A	probably benign	Het
Ifnar2	A	G	16: 91,403,921	D350G	possibly damaging	Het
Ift172	T	C	5: 31,261,866	I1144V	probably benign	Het
Ipo7	A	T	7: 110,029,804	N94Y	possibly damaging	Het
Mapkbp1	C	A	2: 119,998,534	A57D	possibly damaging	Het
Mmd	T	A	11: 90,276,850	I235N	probably benign	Het
Mrvi1	T	A	7: 110,888,045	M699L	probably benign	Het
Naip2	T	C	13: 100,161,854	E558G	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Palld	A	G	8: 61,522,882		probably null	Het
Parp4	G	A	14: 56,590,397	E202K	probably damaging	Het
Pclo	C	A	5: 14,682,177		probably benign	Het
Pde8a	T	C	7: 81,302,294		probably null	Het
Pdgfrb	T	A	18: 61,065,880	L370*	probably null	Het
Phf2	A	T	13: 48,804,477	S1020R	unknown	Het
Pik3r4	T	A	9: 105,650,901		probably null	Het
Plxnb1	C	A	9: 109,100,652	P192Q	possibly damaging	Het
Ppil3	A	T	1: 58,440,878	I46N	probably damaging	Het
Prr14l	A	C	5: 32,830,260	C630W	probably damaging	Het
Rfx5	A	G	3: 94,958,412	I341V	probably benign	Het
Ryr3	T	C	2: 112,750,803	K2895E	probably damaging	Het
Slc5a12	T	C	2: 110,617,090		probably null	Het
Slc8a3	T	C	12: 81,316,016	T10A	probably damaging	Het
Ss18	A	G	18: 14,636,538	Y321H	unknown	Het
Sspo	A	G	6: 48,461,635	N1546D	probably benign	Het
Thbs4	G	A	13: 92,752,417	L923F	probably damaging	Het
Ulk1	C	T	5: 110,789,357	R691Q	probably benign	Het

Other mutations in Hjurp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Hjurp	APN	1	88270269	missense	probably benign	0.04
IGL03099:Hjurp	APN	1	88266289	missense	probably benign	0.09
BB003:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
IGL03097:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03098:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
IGL03147:Hjurp	UTSW	1	88266280	utr 3 prime	probably benign
PIT4131001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
PIT4142001:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
PIT4142001:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
PIT4378001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
PIT4812001:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R0053:Hjurp	UTSW	1	88277215	splice site	probably benign
R0371:Hjurp	UTSW	1	88277368	splice site	probably benign
R0442:Hjurp	UTSW	1	88266524	nonsense	probably null
R0762:Hjurp	UTSW	1	88277215	splice site	probably benign
R0928:Hjurp	UTSW	1	88266524	nonsense	probably null
R1333:Hjurp	UTSW	1	88266046	missense	probably damaging	0.98
R1364:Hjurp	UTSW	1	88266525	frame shift	probably null
R1496:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R1637:Hjurp	UTSW	1	88266121	missense	probably benign	0.03
R1905:Hjurp	UTSW	1	88266616	missense	probably benign	0.04
R1965:Hjurp	UTSW	1	88266524	nonsense	probably null
R1992:Hjurp	UTSW	1	88266524	nonsense	probably null
R2002:Hjurp	UTSW	1	88266524	nonsense	probably null
R2023:Hjurp	UTSW	1	88266524	nonsense	probably null
R2024:Hjurp	UTSW	1	88266524	nonsense	probably null
R2332:Hjurp	UTSW	1	88277215	splice site	probably benign
R2420:Hjurp	UTSW	1	88266524	nonsense	probably null
R2422:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R2869:Hjurp	UTSW	1	88266524	nonsense	probably null
R2870:Hjurp	UTSW	1	88266524	nonsense	probably null
R2871:Hjurp	UTSW	1	88266524	nonsense	probably null
R2872:Hjurp	UTSW	1	88266524	nonsense	probably null
R3019:Hjurp	UTSW	1	88266524	nonsense	probably null
R3021:Hjurp	UTSW	1	88266524	nonsense	probably null
R3150:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R3411:Hjurp	UTSW	1	88266524	nonsense	probably null
R3552:Hjurp	UTSW	1	88266524	nonsense	probably null
R3704:Hjurp	UTSW	1	88277215	splice site	probably benign
R3730:Hjurp	UTSW	1	88266524	nonsense	probably null
R3733:Hjurp	UTSW	1	88266524	nonsense	probably null
R3764:Hjurp	UTSW	1	88266524	nonsense	probably null
R3799:Hjurp	UTSW	1	88277215	splice site	probably benign
R3819:Hjurp	UTSW	1	88277215	splice site	probably benign
R3857:Hjurp	UTSW	1	88266524	nonsense	probably null
R3930:Hjurp	UTSW	1	88266524	nonsense	probably null
R3952:Hjurp	UTSW	1	88277215	splice site	probably benign
R4090:Hjurp	UTSW	1	88277215	splice site	probably benign
R4159:Hjurp	UTSW	1	88277215	splice site	probably benign
R4207:Hjurp	UTSW	1	88277215	splice site	probably benign
R4322:Hjurp	UTSW	1	88277215	splice site	probably benign
R4391:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4392:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266524	nonsense	probably null
R4393:Hjurp	UTSW	1	88266561	utr 3 prime	probably benign
R4397:Hjurp	UTSW	1	88266524	nonsense	probably null
R4700:Hjurp	UTSW	1	88266524	nonsense	probably null
R4808:Hjurp	UTSW	1	88277215	splice site	probably benign
R4900:Hjurp	UTSW	1	88266524	nonsense	probably null
R4901:Hjurp	UTSW	1	88266524	nonsense	probably null
R5023:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5024:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5076:Hjurp	UTSW	1	88266524	nonsense	probably null
R5123:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R5236:Hjurp	UTSW	1	88266524	nonsense	probably null
R5300:Hjurp	UTSW	1	88266524	nonsense	probably null
R5318:Hjurp	UTSW	1	88266524	nonsense	probably null
R5370:Hjurp	UTSW	1	88266524	nonsense	probably null
R5410:Hjurp	UTSW	1	88266524	nonsense	probably null
R5445:Hjurp	UTSW	1	88266316	missense	probably benign	0.43
R5457:Hjurp	UTSW	1	88266525	frame shift	probably null
R5497:Hjurp	UTSW	1	88266320	missense	possibly damaging	0.92
R5560:Hjurp	UTSW	1	88266524	nonsense	probably null
R5561:Hjurp	UTSW	1	88266524	nonsense	probably null
R5615:Hjurp	UTSW	1	88266524	nonsense	probably null
R5661:Hjurp	UTSW	1	88277215	splice site	probably benign
R5722:Hjurp	UTSW	1	88266524	nonsense	probably null
R6087:Hjurp	UTSW	1	88266524	nonsense	probably null
R6089:Hjurp	UTSW	1	88266524	nonsense	probably null
R6090:Hjurp	UTSW	1	88266524	nonsense	probably null
R6125:Hjurp	UTSW	1	88266524	nonsense	probably null
R6175:Hjurp	UTSW	1	88266524	nonsense	probably null
R6362:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R6659:Hjurp	UTSW	1	88266524	nonsense	probably null
R7016:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7016:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7045:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7179:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7200:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R7463:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R7912:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R8215:Hjurp	UTSW	1	88266524	nonsense	probably null
R8968:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9038:Hjurp	UTSW	1	88266524	nonsense	probably null
R9115:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9133:Hjurp	UTSW	1	88275050	missense	possibly damaging	0.59
R9146:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9221:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9475:Hjurp	UTSW	1	88266277	utr 3 prime	probably benign
R9482:Hjurp	UTSW	1	88266274	utr 3 prime	probably benign
R9565:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
R9599:Hjurp	UTSW	1	88266278	utr 3 prime	probably benign
V5622:Hjurp	UTSW	1	88277525	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGCATTGCAAATTCTAGGCCCAC -3'
(R):5'- AAGGAGCCTTGACAGGCAACTCAC -3'

Sequencing Primer
(F):5'- GCAAATTCTAGGCCCACTGTTC -3'
(R):5'- GTTTCCACCGGAAGTGCTC -3'

Posted On

2014-11-05