Incidental Mutation 'R0288:Chmp1a'
ID24731
Institutional Source Beutler Lab
Gene Symbol Chmp1a
Ensembl Gene ENSMUSG00000000743
Gene Namecharged multivesicular body protein 1A
SynonymsPcoln3, chromatin modifying protein 1A, 2900018H07Rik
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123204264-123212763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123208006 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 70 (D70E)
Ref Sequence ENSEMBL: ENSMUSP00000000759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000759] [ENSMUST00000060133] [ENSMUST00000127664] [ENSMUST00000212161] [ENSMUST00000212346] [ENSMUST00000212523] [ENSMUST00000212637] [ENSMUST00000212760] [ENSMUST00000212892]
Predicted Effect probably damaging
Transcript: ENSMUST00000000759
AA Change: D70E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000759
Gene: ENSMUSG00000000743
AA Change: D70E

DomainStartEndE-ValueType
Pfam:Snf7 4 174 6.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060133
SMART Domains Protein: ENSMUSP00000058002
Gene: ENSMUSG00000048478

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
Pfam:DUF4609 63 130 3.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212107
Predicted Effect probably benign
Transcript: ENSMUST00000212161
Predicted Effect probably benign
Transcript: ENSMUST00000212346
Predicted Effect probably benign
Transcript: ENSMUST00000212523
Predicted Effect probably benign
Transcript: ENSMUST00000212637
Predicted Effect probably benign
Transcript: ENSMUST00000212760
Predicted Effect probably benign
Transcript: ENSMUST00000212892
Meta Mutation Damage Score 0.7004 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHMP/Chmp family of proteins which are involved in multivesicular body sorting of proteins to the interiors of lysosomes. The initial prediction of the protein sequence encoded by this gene suggested that the encoded protein was a metallopeptidase. The nomenclature has been updated recently to reflect the correct biological function of this encoded protein. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Chmp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Chmp1a APN 8 123209019 critical splice donor site probably null
IGL01872:Chmp1a APN 8 123206237 missense probably damaging 1.00
IGL02964:Chmp1a APN 8 123208067 missense probably damaging 0.98
R2074:Chmp1a UTSW 8 123208022 missense probably damaging 0.98
R2075:Chmp1a UTSW 8 123208022 missense probably damaging 0.98
R5070:Chmp1a UTSW 8 123206315 missense probably benign 0.13
R5840:Chmp1a UTSW 8 123208100 missense probably benign 0.22
Z1177:Chmp1a UTSW 8 123206331 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGAATGACATTAGGAGACCCAGGC -3'
(R):5'- GTGGCATTGCACTTCACAGAGC -3'

Sequencing Primer
(F):5'- ATTAGGAGACCCAGGCTGTCC -3'
(R):5'- CATTCCTGAGGGCTGTACC -3'
Posted On2013-04-16