Incidental Mutation 'R0288:Capn9'
ID24732
Institutional Source Beutler Lab
Gene Symbol Capn9
Ensembl Gene ENSMUSG00000031981
Gene Namecalpain 9
SynonymsGC36, nCL-4
MMRRC Submission 038507-MU
Accession Numbers

Genbank: NM_023709; MGI: 1920897

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location124576111-124618731 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 124600491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093033]
Predicted Effect probably benign
Transcript: ENSMUST00000093033
SMART Domains Protein: ENSMUSP00000090717
Gene: ENSMUSG00000031981

DomainStartEndE-ValueType
CysPc 24 345 1.53e-196 SMART
calpain_III 348 494 1.91e-87 SMART
low complexity region 504 522 N/A INTRINSIC
EFh 565 593 1.25e-2 SMART
EFh 595 623 2.64e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Capn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Capn9 APN 8 124591769 missense probably benign
IGL01987:Capn9 APN 8 124576226 missense probably benign 0.01
IGL02150:Capn9 APN 8 124613843 missense probably benign 0.01
IGL02348:Capn9 APN 8 124594677 missense probably damaging 1.00
IGL02720:Capn9 APN 8 124600497 splice site probably benign
IGL02723:Capn9 APN 8 124609183 splice site probably benign
IGL03065:Capn9 APN 8 124605559 missense probably damaging 1.00
IGL03169:Capn9 APN 8 124605877 missense probably damaging 1.00
A2778:Capn9 UTSW 8 124605478 missense possibly damaging 0.95
R1353:Capn9 UTSW 8 124605566 splice site probably null
R1611:Capn9 UTSW 8 124611512 missense possibly damaging 0.90
R1672:Capn9 UTSW 8 124613831 missense probably benign 0.03
R1682:Capn9 UTSW 8 124611565 splice site probably null
R1729:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1739:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1762:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1783:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1784:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1785:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1836:Capn9 UTSW 8 124605565 critical splice donor site probably null
R1883:Capn9 UTSW 8 124611558 missense probably benign
R1924:Capn9 UTSW 8 124576226 missense probably benign 0.01
R2008:Capn9 UTSW 8 124591685 missense probably damaging 1.00
R2049:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2069:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2131:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2141:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2219:Capn9 UTSW 8 124609159 nonsense probably null
R4193:Capn9 UTSW 8 124600486 missense probably null 0.00
R4707:Capn9 UTSW 8 124613456 missense possibly damaging 0.82
R5092:Capn9 UTSW 8 124597525 missense probably damaging 1.00
R5386:Capn9 UTSW 8 124605540 missense possibly damaging 0.83
R5697:Capn9 UTSW 8 124589071 missense unknown
R5734:Capn9 UTSW 8 124605844 missense probably damaging 1.00
R5999:Capn9 UTSW 8 124589078 missense probably damaging 1.00
R6026:Capn9 UTSW 8 124605862 missense probably damaging 1.00
R6298:Capn9 UTSW 8 124617454 missense probably benign
R6787:Capn9 UTSW 8 124616185 missense probably benign 0.00
R6856:Capn9 UTSW 8 124597569 missense probably damaging 1.00
R7131:Capn9 UTSW 8 124576278 missense probably damaging 1.00
R7149:Capn9 UTSW 8 124605709 missense probably benign 0.00
RF015:Capn9 UTSW 8 124618482 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCACCTCTGGGTCTCATGGATG -3'
(R):5'- TGGGCTTCAGCCAGTGATCAATG -3'

Sequencing Primer
(F):5'- GGATGACTAAAGGCTTCATGCTC -3'
(R):5'- cacacacacacatacacacac -3'
Posted On2013-04-16