Incidental Mutation 'R0288:Zfp280d'
ID24735
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Namezinc finger protein 280D
SynonymsSuhw4
MMRRC Submission 038507-MU
Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72274860-72363777 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 72331339 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 646 (K646*)
Ref Sequence ENSEMBL: ENSMUSP00000138970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184019] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
Predicted Effect probably null
Transcript: ENSMUST00000098576
AA Change: K646*
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: K646*

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183410
AA Change: K646*
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: K646*

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183459
Predicted Effect probably benign
Transcript: ENSMUST00000183801
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184019
AA Change: K32*
SMART Domains Protein: ENSMUSP00000138994
Gene: ENSMUSG00000038535
AA Change: K32*

DomainStartEndE-ValueType
ZnF_C2H2 42 65 1.23e1 SMART
ZnF_C2H2 88 112 1.34e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184025
Predicted Effect probably null
Transcript: ENSMUST00000184036
AA Change: K621*
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535
AA Change: K621*

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184141
Predicted Effect probably benign
Transcript: ENSMUST00000184399
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184517
AA Change: K646*
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: K646*

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72322571 missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72312135 missense probably benign 0.19
IGL01333:Zfp280d APN 9 72335114 splice site probably benign
IGL01453:Zfp280d APN 9 72322586 missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72301711 missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72322445 splice site probably benign
IGL02608:Zfp280d APN 9 72307979 missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72312222 missense probably benign 0.33
IGL02676:Zfp280d APN 9 72335074 missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72296025 missense probably benign 0.02
IGL03076:Zfp280d APN 9 72312662 missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0419:Zfp280d UTSW 9 72312237 missense probably benign 0.02
R0540:Zfp280d UTSW 9 72307965 missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72361948 missense probably benign
R0722:Zfp280d UTSW 9 72312101 missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72329167 splice site probably null
R1786:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72298780 missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72335080 nonsense probably null
R2130:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72312729 missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72298822 missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72301770 splice site probably benign
R2269:Zfp280d UTSW 9 72301770 splice site probably benign
R2278:Zfp280d UTSW 9 72338773 nonsense probably null
R2850:Zfp280d UTSW 9 72312089 missense probably benign 0.06
R3780:Zfp280d UTSW 9 72322524 missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72296019 missense possibly damaging 0.49
R4330:Zfp280d UTSW 9 72295979 missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72312665 missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72298858 splice site probably benign
R4909:Zfp280d UTSW 9 72331432 missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72308113 unclassified probably benign
R5518:Zfp280d UTSW 9 72324135 missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72330942 missense probably benign 0.20
R5945:Zfp280d UTSW 9 72362332 nonsense probably null
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72319257 missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72361942 missense possibly damaging 0.65
R7658:Zfp280d UTSW 9 72324072 missense probably damaging 1.00
R7667:Zfp280d UTSW 9 72301965 missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72331319 missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72312671 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTGACCCCAGTAAAGCTAATGAGACC -3'
(R):5'- TGTTGCCAGCATCACTGAAAATCCTC -3'

Sequencing Primer
(F):5'- CACTAAGGAACTTAAGGTAATGCCTC -3'
(R):5'- GACTGATTTGAAGAGAATGACATCC -3'
Posted On2013-04-16