Incidental Mutation 'R2349:Slco5a1'
ID247377
Institutional Source Beutler Lab
Gene Symbol Slco5a1
Ensembl Gene ENSMUSG00000025938
Gene Namesolute carrier organic anion transporter family, member 5A1
SynonymsA630033C23Rik
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location12866549-12992650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12921152 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 438 (V438M)
Ref Sequence ENSEMBL: ENSMUSP00000140658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115402] [ENSMUST00000115403] [ENSMUST00000136197] [ENSMUST00000146763] [ENSMUST00000147606] [ENSMUST00000188454]
Predicted Effect probably damaging
Transcript: ENSMUST00000115402
AA Change: V438M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111061
Gene: ENSMUSG00000025938
AA Change: V438M

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115403
AA Change: V438M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111062
Gene: ENSMUSG00000025938
AA Change: V438M

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 547 2.8e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133201
Predicted Effect probably damaging
Transcript: ENSMUST00000136197
AA Change: V438M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139533
Gene: ENSMUSG00000025938
AA Change: V438M

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 3.6e-27 PFAM
KAZAL 559 601 4.3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146763
SMART Domains Protein: ENSMUSP00000139586
Gene: ENSMUSG00000025938

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 352 8.4e-72 PFAM
Pfam:MFS_1 137 332 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147606
AA Change: V438M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140658
Gene: ENSMUSG00000025938
AA Change: V438M

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:OATP 130 478 1.5e-105 PFAM
Pfam:MFS_1 137 476 2.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188454
AA Change: V438M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140091
Gene: ENSMUSG00000025938
AA Change: V438M

DomainStartEndE-ValueType
low complexity region 80 93 N/A INTRINSIC
Pfam:MFS_1 137 548 4.1e-28 PFAM
KAZAL 559 602 3.26e-2 SMART
transmembrane domain 737 759 N/A INTRINSIC
Meta Mutation Damage Score 0.3177 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 12 transmembrane domain protein that is a member of the solute carrier organic anion transporter superfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Slco5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Slco5a1 APN 1 12871995 missense probably benign 0.01
IGL02330:Slco5a1 APN 1 12939060 missense probably damaging 1.00
IGL02660:Slco5a1 APN 1 12989636 missense probably damaging 1.00
IGL02904:Slco5a1 APN 1 12921097 missense probably damaging 0.98
IGL02972:Slco5a1 APN 1 12990155 nonsense probably null
IGL03100:Slco5a1 APN 1 12879280 missense possibly damaging 0.67
IGL03270:Slco5a1 APN 1 12872028 missense probably benign
R0969:Slco5a1 UTSW 1 12989892 missense probably damaging 1.00
R1337:Slco5a1 UTSW 1 12939142 missense probably benign 0.01
R1434:Slco5a1 UTSW 1 12871908 missense probably benign 0.00
R1627:Slco5a1 UTSW 1 12990383 missense probably damaging 1.00
R1767:Slco5a1 UTSW 1 12989615 missense probably damaging 1.00
R1893:Slco5a1 UTSW 1 12894472 missense probably damaging 1.00
R1894:Slco5a1 UTSW 1 12872259 missense probably damaging 1.00
R2301:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2302:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2303:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2304:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R2351:Slco5a1 UTSW 1 12989934 missense probably benign 0.05
R3079:Slco5a1 UTSW 1 12879262 missense probably damaging 0.98
R3949:Slco5a1 UTSW 1 12989609 missense probably damaging 1.00
R4197:Slco5a1 UTSW 1 12894516 missense probably damaging 1.00
R4380:Slco5a1 UTSW 1 12939168 missense probably damaging 0.96
R4532:Slco5a1 UTSW 1 12879223 missense probably damaging 1.00
R4750:Slco5a1 UTSW 1 12879280 missense probably damaging 1.00
R5891:Slco5a1 UTSW 1 12990402 missense probably benign 0.04
R6024:Slco5a1 UTSW 1 12944070 missense probably damaging 1.00
R6332:Slco5a1 UTSW 1 12921185 missense probably benign 0.27
R6492:Slco5a1 UTSW 1 12989927 missense probably damaging 1.00
R6860:Slco5a1 UTSW 1 12881196 intron probably benign
R6994:Slco5a1 UTSW 1 12881393 missense probably damaging 1.00
R7121:Slco5a1 UTSW 1 12990437 missense probably benign 0.00
R7747:Slco5a1 UTSW 1 12990122 missense probably benign 0.05
R7802:Slco5a1 UTSW 1 12990476 missense possibly damaging 0.76
R7895:Slco5a1 UTSW 1 12989703 missense possibly damaging 0.52
R7984:Slco5a1 UTSW 1 12881384 missense probably damaging 1.00
R8172:Slco5a1 UTSW 1 12990266 nonsense probably null
R8536:Slco5a1 UTSW 1 12881301 missense possibly damaging 0.69
RF010:Slco5a1 UTSW 1 12871947 missense probably damaging 1.00
X0065:Slco5a1 UTSW 1 12872212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGAGTGTGACCTAGACCC -3'
(R):5'- AGCCAATCATCAGAGCTTCC -3'

Sequencing Primer
(F):5'- GAGTGTGACCTAGACCCTCTATTC -3'
(R):5'- GCCAATCATCAGAGCTTCCTGTTG -3'
Posted On2014-11-11