Incidental Mutation 'R2349:Ifi209'
ID247379
Institutional Source Beutler Lab
Gene Symbol Ifi209
Ensembl Gene ENSMUSG00000043263
Gene Nameinterferon activated gene 209
SynonymsIfix, Pyhin1, Pyhin-1
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173630917-173647928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 173642556 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 237 (V237M)
Ref Sequence ENSEMBL: ENSMUSP00000061900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056071] [ENSMUST00000193727]
Predicted Effect probably damaging
Transcript: ENSMUST00000056071
AA Change: V237M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061900
Gene: ENSMUSG00000043263
AA Change: V237M

DomainStartEndE-ValueType
PYRIN 6 83 3.54e-17 SMART
low complexity region 152 169 N/A INTRINSIC
Pfam:HIN 231 396 4.2e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193727
SMART Domains Protein: ENSMUSP00000142161
Gene: ENSMUSG00000043263

DomainStartEndE-ValueType
PYRIN 6 83 1.7e-21 SMART
low complexity region 152 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200598
Meta Mutation Damage Score 0.3906 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Ifi209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ifi209 APN 1 173638963 missense possibly damaging 0.88
IGL02598:Ifi209 APN 1 173644715 missense probably damaging 0.99
IGL02712:Ifi209 APN 1 173642701 missense possibly damaging 0.68
IGL03131:Ifi209 APN 1 173641234 missense possibly damaging 0.86
IGL03368:Ifi209 APN 1 173642491 missense possibly damaging 0.91
R0880:Ifi209 UTSW 1 173644813 missense probably damaging 1.00
R1317:Ifi209 UTSW 1 173637463 missense possibly damaging 0.96
R1640:Ifi209 UTSW 1 173637365 missense probably damaging 0.98
R1769:Ifi209 UTSW 1 173641162 missense probably benign 0.11
R5096:Ifi209 UTSW 1 173644734 missense probably benign 0.17
R5369:Ifi209 UTSW 1 173637307 start codon destroyed probably null 1.00
R5484:Ifi209 UTSW 1 173641074 missense probably benign 0.18
R5532:Ifi209 UTSW 1 173638976 missense probably damaging 0.99
R5551:Ifi209 UTSW 1 173641197 missense probably benign 0.01
R5554:Ifi209 UTSW 1 173641197 missense probably benign 0.01
R5749:Ifi209 UTSW 1 173637327 missense probably damaging 1.00
R5960:Ifi209 UTSW 1 173638816 splice site probably null
R6401:Ifi209 UTSW 1 173644703 missense probably damaging 0.99
R7042:Ifi209 UTSW 1 173642670 missense probably benign 0.34
R7304:Ifi209 UTSW 1 173642590 missense possibly damaging 0.88
R7521:Ifi209 UTSW 1 173642695 missense probably damaging 0.97
R7742:Ifi209 UTSW 1 173642632 missense probably damaging 1.00
R7763:Ifi209 UTSW 1 173642879 missense probably damaging 1.00
R7975:Ifi209 UTSW 1 173641156 missense probably benign 0.24
R8498:Ifi209 UTSW 1 173642503 missense probably benign 0.05
R8873:Ifi209 UTSW 1 173642590 missense probably damaging 1.00
Z1088:Ifi209 UTSW 1 173637407 missense probably damaging 0.99
Z1088:Ifi209 UTSW 1 173641146 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGAAATTATTACCCACATCTCC -3'
(R):5'- TTTACCTCTGACACACTAGATGC -3'

Sequencing Primer
(F):5'- CCACATCTCCATTTCTTCTAAGAAC -3'
(R):5'- ATTTATGAACCCATTGCAGCC -3'
Posted On2014-11-11