Incidental Mutation 'R2349:Wwp1'
ID247384
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19638644 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 566 (N566K)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035982
AA Change: N566K

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: N566K

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108246
AA Change: N566K

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: N566K

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7017:Wwp1 UTSW 4 19623124 missense probably damaging 1.00
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7947:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R8006:Wwp1 UTSW 4 19650174 missense probably benign
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AATGGTTTGCCTCCGTGTATGC -3'
(R):5'- TGAACGCAGCTTTAGGTGGAAG -3'

Sequencing Primer
(F):5'- TCCGGCCCACATAACAGTTTC -3'
(R):5'- AGGTGGAAGCTTGCTCACTTCC -3'
Posted On2014-11-11