Mutagenetix > Incidental Mutations

Incidental Mutation 'R2349:Xpo6'

247388

Institutional Source

Beutler Lab

Gene Symbol

Xpo6

Ensembl Gene

ENSMUSG00000000131

Gene Name

exportin 6

Synonyms

2610005L19Rik, C230091E20Rik, Ranbp20

MMRRC Submission

040331-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.750) question?

Stock #

R2349 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126101715-126200501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 126113703 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 701 (V701E)

Ref Sequence

ENSEMBL: ENSMUSP00000009344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000165608] [ENSMUST00000166538] [ENSMUST00000168189]

Predicted Effect

probably benign
Transcript: ENSMUST00000009344
AA Change: V701E

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: V701E

Domain	Start	End	E-Value	Type
IBN_N	31	97	4.04e-6	SMART
Pfam:Xpo1	103	290	1.4e-29	PFAM
low complexity region	469	484	N/A	INTRINSIC
low complexity region	672	684	N/A	INTRINSIC
low complexity region	1022	1034	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165608

Predicted Effect

probably benign
Transcript: ENSMUST00000165660

Predicted Effect

probably benign
Transcript: ENSMUST00000166538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167268

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167315

Predicted Effect

probably benign
Transcript: ENSMUST00000168189
AA Change: V702E

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: V702E

Domain	Start	End	E-Value	Type
IBN_N	31	97	4.04e-6	SMART
Pfam:Xpo1	103	290	1.1e-25	PFAM
low complexity region	469	485	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170675

Meta Mutation Damage Score

0.7003

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	C	8: 43,652,378	K77E	probably damaging	Het
Arfgef2	T	A	2: 166,852,028	I507N	probably damaging	Het
Atg16l2	T	C	7: 101,296,539	K231E	probably damaging	Het
C1s1	C	A	6: 124,541,473		probably benign	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Cntrl	A	G	2: 35,176,251	T1739A	probably benign	Het
Col15a1	G	A	4: 47,306,742	M289I	probably damaging	Het
Crebbp	G	A	16: 4,138,910	R350C	probably damaging	Het
Dbx2	A	G	15: 95,624,959	V289A	probably benign	Het
Esam	A	C	9: 37,528,231	Q4P	probably benign	Het
Galnt1	A	G	18: 24,280,028	M462V	probably benign	Het
Got1l1	T	C	8: 27,197,931	T357A	probably benign	Het
Gpr182	T	A	10: 127,750,937	K48N	probably damaging	Het
Hdlbp	A	G	1: 93,422,234		probably benign	Het
Ifi209	G	A	1: 173,642,556	V237M	probably damaging	Het
Igf2r	A	T	17: 12,722,311		probably null	Het
Jmjd1c	T	C	10: 67,255,500	M2520T	probably benign	Het
Krt222	A	G	11: 99,238,765		probably benign	Het
Nkx2-9	A	G	12: 56,612,222	L69P	probably benign	Het
Papss1	A	G	3: 131,599,866	D203G	probably benign	Het
Pex13	A	G	11: 23,655,789	M147T	probably damaging	Het
Pkd1l1	A	T	11: 8,826,819		probably null	Het
Rac2	A	G	15: 78,565,475	V85A	possibly damaging	Het
Rock2	A	G	12: 16,977,615	N127S	probably benign	Het
Sfswap	C	T	5: 129,569,738	R875C	possibly damaging	Het
Slco5a1	C	T	1: 12,921,152	V438M	probably damaging	Het
Thsd4	A	G	9: 59,972,515	Y620H	probably benign	Het
Trip4	T	C	9: 65,866,562	D246G	probably benign	Het
Usp10	T	C	8: 119,956,709	*88R	probably null	Het
Vars	A	G	17: 35,015,752	I1186V	probably benign	Het
Vps13c	A	G	9: 67,957,526	D3039G	possibly damaging	Het
Wwp1	A	T	4: 19,638,644	N566K	possibly damaging	Het

Other mutations in Xpo6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01111:Xpo6	APN	7	126129568	missense	probably benign	0.03
IGL01432:Xpo6	APN	7	126124381	missense	probably benign	0.31
IGL01627:Xpo6	APN	7	126149334	missense	probably damaging	1.00
IGL01878:Xpo6	APN	7	126174193	missense	probably benign	0.35
IGL02185:Xpo6	APN	7	126113808	splice site	probably benign
IGL02744:Xpo6	APN	7	126108448	unclassified	probably benign
IGL02927:Xpo6	APN	7	126156729	missense	possibly damaging	0.86
IGL03216:Xpo6	APN	7	126104813	missense	probably damaging	1.00
Cerise	UTSW	7	126108844	missense	probably damaging	1.00
Crayola	UTSW	7	126107078	missense	probably damaging	0.98
pastel	UTSW	7	126108619	missense	probably damaging	1.00
R0845:Xpo6	UTSW	7	126129543	splice site	probably benign
R1671:Xpo6	UTSW	7	126108543	missense	possibly damaging	0.92
R3051:Xpo6	UTSW	7	126104721	missense	probably damaging	1.00
R3052:Xpo6	UTSW	7	126104721	missense	probably damaging	1.00
R3053:Xpo6	UTSW	7	126104721	missense	probably damaging	1.00
R3902:Xpo6	UTSW	7	126120409	missense	probably damaging	1.00
R4011:Xpo6	UTSW	7	126140608	missense	probably benign	0.13
R4231:Xpo6	UTSW	7	126174182	missense	possibly damaging	0.66
R4569:Xpo6	UTSW	7	126128255	missense	probably damaging	1.00
R4604:Xpo6	UTSW	7	126113752	missense	possibly damaging	0.52
R4736:Xpo6	UTSW	7	126140583	missense	probably benign
R4919:Xpo6	UTSW	7	126152943	missense	probably benign	0.01
R4953:Xpo6	UTSW	7	126169271	missense	probably damaging	1.00
R5017:Xpo6	UTSW	7	126104747	missense	probably benign	0.31
R5590:Xpo6	UTSW	7	126107078	missense	probably damaging	0.98
R5856:Xpo6	UTSW	7	126149502	intron	probably benign
R6077:Xpo6	UTSW	7	126109952	missense	possibly damaging	0.67
R6156:Xpo6	UTSW	7	126108844	missense	probably damaging	1.00
R6256:Xpo6	UTSW	7	126108619	missense	probably damaging	1.00
R6481:Xpo6	UTSW	7	126112885	missense	probably damaging	1.00
R6500:Xpo6	UTSW	7	126171090	intron	probably benign
R7407:Xpo6	UTSW	7	126171052	missense	probably damaging	0.99
R7480:Xpo6	UTSW	7	126102333	nonsense	probably null
R7794:Xpo6	UTSW	7	126160863	missense	probably damaging	0.98
X0012:Xpo6	UTSW	7	126169227	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CAGAGAAACCGGTAAGTTGTGC -3'
(R):5'- AGTCATTAACTGCTGCCAACTG -3'

Sequencing Primer
(F):5'- GGTAAGTTGTGCCAATGCTACCC -3'
(R):5'- TAACTGCTGCCAACTGAGGGAAC -3'

Posted On

2014-11-11