Incidental Mutation 'R2349:Got1l1'
ID247389
Institutional Source Beutler Lab
Gene Symbol Got1l1
Ensembl Gene ENSMUSG00000039720
Gene Nameglutamic-oxaloacetic transaminase 1-like 1
Synonyms
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2349 (G1)
Quality Score181
Status Validated
Chromosome8
Chromosomal Location27197459-27223828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27197931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 357 (T357A)
Ref Sequence ENSEMBL: ENSMUSP00000041337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038174] [ENSMUST00000209299]
Predicted Effect probably benign
Transcript: ENSMUST00000038174
AA Change: T357A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041337
Gene: ENSMUSG00000039720
AA Change: T357A

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 32 395 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209281
Predicted Effect probably benign
Transcript: ENSMUST00000209299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211002
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Got1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Got1l1 APN 8 27197991 missense probably damaging 1.00
IGL02094:Got1l1 APN 8 27199845 missense probably benign 0.10
IGL03155:Got1l1 APN 8 27199332 missense probably damaging 1.00
IGL03395:Got1l1 APN 8 27200857 missense probably benign 0.00
R0026:Got1l1 UTSW 8 27200248 missense probably benign 0.00
R1086:Got1l1 UTSW 8 27197979 missense probably damaging 1.00
R1403:Got1l1 UTSW 8 27200717 splice site probably null
R1403:Got1l1 UTSW 8 27200717 splice site probably null
R3413:Got1l1 UTSW 8 27199836 critical splice donor site probably null
R4513:Got1l1 UTSW 8 27198485 missense probably benign 0.27
R4514:Got1l1 UTSW 8 27198485 missense probably benign 0.27
R5686:Got1l1 UTSW 8 27198059 missense probably damaging 1.00
R5979:Got1l1 UTSW 8 27197923 splice site probably null
R6023:Got1l1 UTSW 8 27199904 nonsense probably null
R6229:Got1l1 UTSW 8 27198436 splice site probably null
R7635:Got1l1 UTSW 8 27197934 missense probably damaging 1.00
R8101:Got1l1 UTSW 8 27200302 missense possibly damaging 0.68
R8104:Got1l1 UTSW 8 27197591 missense probably damaging 1.00
R8298:Got1l1 UTSW 8 27198558 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGAATTCCTCTCAAGACCATGGG -3'
(R):5'- GGCCTTTGCAGTCCAGTTTC -3'

Sequencing Primer
(F):5'- CCTCTCAAGACCATGGGGGAAG -3'
(R):5'- GCAGTCCAGTTTCCTGCTC -3'
Posted On2014-11-11