Mutagenetix > Incidental Mutations

Incidental Mutation 'R0288:Gnptab'

24739

Institutional Source

Beutler Lab

Gene Symbol

Gnptab

Ensembl Gene

ENSMUSG00000035311

Gene Name

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

Synonyms

EG432486

MMRRC Submission

038507-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R0288 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88379132-88447329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88433105 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 557 (V557I)

Ref Sequence

ENSEMBL: ENSMUSP00000020251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]

Predicted Effect

probably benign
Transcript: ENSMUST00000020251
AA Change: V557I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: V557I

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
Pfam:Stealth_CR1	73	101	6.6e-14	PFAM
Pfam:Stealth_CR2	322	429	8.8e-49	PFAM
NL	431	469	3.82e-7	SMART
low complexity region	480	490	N/A	INTRINSIC
NL	498	536	2.37e-2	SMART
DMAP_binding	699	813	6.14e-38	SMART
Pfam:Stealth_CR3	934	982	2.9e-21	PFAM
Pfam:Stealth_CR4	1117	1173	7.9e-28	PFAM
transmembrane domain	1192	1214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132738

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141343

Predicted Effect

probably benign
Transcript: ENSMUST00000151273

SMART Domains

Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155306

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.1%
20x: 89.7%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg3	A	G	8: 95,039,940	E413G	possibly damaging	Het
Amigo2	G	T	15: 97,245,679	N287K	probably damaging	Het
Ankle2	T	A	5: 110,236,390	I260K	probably damaging	Het
Apob	C	T	12: 7,990,779	R635*	probably null	Het
Camkv	A	G	9: 107,946,356	Y153C	probably damaging	Het
Capn9	A	G	8: 124,600,491		probably benign	Het
Ces2c	A	G	8: 104,849,744	I130V	probably benign	Het
Cfap44	T	A	16: 44,415,894		probably benign	Het
Cfhr3	A	G	1: 139,597,687		noncoding transcript	Het
Chmp1a	G	T	8: 123,208,006	D70E	probably damaging	Het
Coil	G	A	11: 88,981,868	G352R	probably damaging	Het
Colq	T	C	14: 31,543,992	E188G	possibly damaging	Het
Cyfip2	A	G	11: 46,253,972	F685S	possibly damaging	Het
Cyp4f39	A	G	17: 32,492,436	N519S	probably benign	Het
Dennd1c	A	T	17: 57,076,870		probably null	Het
Dnah9	A	T	11: 66,025,134		probably null	Het
Dnmbp	T	C	19: 43,902,459	T290A	possibly damaging	Het
Dsc2	T	C	18: 20,033,120	D818G	probably damaging	Het
Hdac4	A	T	1: 91,971,006	H675Q	probably damaging	Het
Kcnk3	T	C	5: 30,588,420	M35T	probably benign	Het
Kif1b	A	T	4: 149,199,338	I1290N	probably damaging	Het
Klhl14	G	A	18: 21,565,563	R398W	probably damaging	Het
Marveld1	T	C	19: 42,147,826	F60L	probably damaging	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Ndst3	A	T	3: 123,672,194	V43D	probably benign	Het
Nhsl1	A	G	10: 18,524,046	D306G	probably damaging	Het
Nlrp2	A	G	7: 5,328,545	V284A	probably benign	Het
Pcdhb15	T	C	18: 37,475,398	V561A	probably damaging	Het
Pdcl2	T	C	5: 76,312,497	I177V	possibly damaging	Het
Pkd1l3	G	A	8: 109,646,499		probably null	Het
Pla2g6	A	C	15: 79,286,906		probably benign	Het
Plekhj1	A	T	10: 80,796,610	I122N	probably damaging	Het
Pmel	T	C	10: 128,714,306	I70T	probably benign	Het
Psip1	T	C	4: 83,464,959	D273G	probably damaging	Het
Rictor	A	G	15: 6,786,540	I1098V	probably benign	Het
Rif1	T	C	2: 52,110,013	S1160P	probably damaging	Het
Rsbn1l	T	C	5: 20,920,040	I255V	probably damaging	Het
Slc15a5	A	G	6: 138,017,916		probably benign	Het
Slc29a1	G	A	17: 45,589,804	R111W	probably damaging	Het
Slc36a1	G	A	11: 55,219,087	A74T	probably damaging	Het
Slc5a7	A	T	17: 54,293,018	Y122*	probably null	Het
Slc6a3	G	T	13: 73,560,928	G324W	probably damaging	Het
Sltm	T	C	9: 70,579,351	S433P	probably damaging	Het
Spta1	T	C	1: 174,243,179	S2190P	probably damaging	Het
Sry	A	T	Y: 2,662,818	F281I	unknown	Het
Stk32a	T	A	18: 43,304,995		probably null	Het
Sytl2	T	C	7: 90,403,020		probably benign	Het
Tbl3	G	A	17: 24,701,807	H612Y	probably damaging	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Top2a	A	G	11: 99,016,423		probably benign	Het
Usp9y	A	T	Y: 1,333,606		probably benign	Het
Vldlr	G	A	19: 27,240,651		probably benign	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vmn2r28	A	G	7: 5,488,021	L409P	probably damaging	Het
Vps13c	T	C	9: 67,927,366	V1659A	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zfp280d	A	T	9: 72,331,339	K646*	probably null	Het
Zfp36	A	G	7: 28,378,241	S81P	probably benign	Het
Zfp618	A	T	4: 63,132,934	T651S	possibly damaging	Het

Other mutations in Gnptab

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01326:Gnptab	APN	10	88433065	missense	probably damaging	0.99
IGL01346:Gnptab	APN	10	88436179	missense	possibly damaging	0.65
IGL01626:Gnptab	APN	10	88437495	missense	probably damaging	0.98
IGL01642:Gnptab	APN	10	88436132	missense	possibly damaging	0.89
IGL02121:Gnptab	APN	10	88429461	missense	possibly damaging	0.90
IGL03076:Gnptab	APN	10	88440289	missense	possibly damaging	0.91
IGL03130:Gnptab	APN	10	88436371	missense	possibly damaging	0.95
maze	UTSW	10	88432573	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0103:Gnptab	UTSW	10	88429519	missense	probably damaging	1.00
R0114:Gnptab	UTSW	10	88433400	missense	possibly damaging	0.48
R0206:Gnptab	UTSW	10	88439510	missense	probably damaging	0.98
R0329:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0330:Gnptab	UTSW	10	88440309	missense	probably damaging	1.00
R0369:Gnptab	UTSW	10	88433594	missense	possibly damaging	0.87
R0385:Gnptab	UTSW	10	88436525	missense	probably damaging	1.00
R0522:Gnptab	UTSW	10	88431466	splice site	probably benign
R0569:Gnptab	UTSW	10	88428557	missense	possibly damaging	0.89
R0671:Gnptab	UTSW	10	88443304	splice site	probably benign
R0834:Gnptab	UTSW	10	88429952	missense	probably damaging	1.00
R1375:Gnptab	UTSW	10	88432573	missense	probably damaging	1.00
R1443:Gnptab	UTSW	10	88434081	missense	probably damaging	1.00
R1464:Gnptab	UTSW	10	88445754	splice site	probably benign
R1471:Gnptab	UTSW	10	88445763	missense	probably benign
R1570:Gnptab	UTSW	10	88419454	missense	probably damaging	0.99
R1612:Gnptab	UTSW	10	88428482	splice site	probably null
R1614:Gnptab	UTSW	10	88414589	missense	probably benign
R1638:Gnptab	UTSW	10	88436167	missense	possibly damaging	0.94
R1739:Gnptab	UTSW	10	88436095	missense	probably benign	0.14
R1894:Gnptab	UTSW	10	88419127	missense	possibly damaging	0.69
R2092:Gnptab	UTSW	10	88440305	nonsense	probably null
R2118:Gnptab	UTSW	10	88436398	missense	probably benign	0.13
R2144:Gnptab	UTSW	10	88428506	missense	possibly damaging	0.89
R2174:Gnptab	UTSW	10	88434044	missense	probably damaging	1.00
R3847:Gnptab	UTSW	10	88433577	nonsense	probably null
R3943:Gnptab	UTSW	10	88433894	missense	probably benign
R4434:Gnptab	UTSW	10	88412622	missense	probably damaging	1.00
R4545:Gnptab	UTSW	10	88414595	missense	probably benign	0.00
R4776:Gnptab	UTSW	10	88436528	missense	probably damaging	1.00
R4786:Gnptab	UTSW	10	88436182	missense	probably damaging	1.00
R4880:Gnptab	UTSW	10	88432551	nonsense	probably null
R4889:Gnptab	UTSW	10	88433913	missense	probably benign	0.00
R4923:Gnptab	UTSW	10	88429623	missense	probably benign	0.17
R5694:Gnptab	UTSW	10	88414486	missense	probably benign	0.01
R5943:Gnptab	UTSW	10	88433514	missense	probably benign	0.00
R6027:Gnptab	UTSW	10	88433225	missense	probably damaging	0.98
R6074:Gnptab	UTSW	10	88433078	missense	probably damaging	1.00
R6119:Gnptab	UTSW	10	88431395	missense	probably damaging	1.00
R6182:Gnptab	UTSW	10	88429480	missense	possibly damaging	0.71
R6757:Gnptab	UTSW	10	88437502	missense	probably damaging	0.98
R6910:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R6911:Gnptab	UTSW	10	88431396	missense	probably damaging	1.00
R7094:Gnptab	UTSW	10	88379504	missense	possibly damaging	0.66
R7101:Gnptab	UTSW	10	88440312	missense	probably benign	0.19
R7164:Gnptab	UTSW	10	88434070	nonsense	probably null
R7214:Gnptab	UTSW	10	88379157	unclassified	probably benign
R7316:Gnptab	UTSW	10	88400710	missense	probably damaging	1.00
R7463:Gnptab	UTSW	10	88431389	missense	probably damaging	1.00
R7596:Gnptab	UTSW	10	88443370	missense	probably damaging	0.99
R7654:Gnptab	UTSW	10	88445819	missense	possibly damaging	0.63
R7722:Gnptab	UTSW	10	88379528	missense	probably damaging	0.99
X0064:Gnptab	UTSW	10	88436530	missense	probably damaging	1.00
X0066:Gnptab	UTSW	10	88412011	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCAAGCCTGTAACGTCTTATCCTGC -3'
(R):5'- TGGTTGCGTTCATCCCACTGTG -3'

Sequencing Primer
(F):5'- ACCCTTTAAGTGACACTCGATGG -3'
(R):5'- ATCCCACTGTGCATTATCAGG -3'

Posted On

2013-04-16