Incidental Mutation 'R2349:Esam'
ID247393
Institutional Source Beutler Lab
Gene Symbol Esam
Ensembl Gene ENSMUSG00000001946
Gene Nameendothelial cell-specific adhesion molecule
Synonyms2310008D05Rik, W117m
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37528078-37538319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37528231 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 4 (Q4P)
Ref Sequence ENSEMBL: ENSMUSP00000002011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002011] [ENSMUST00000048604] [ENSMUST00000123198] [ENSMUST00000144596] [ENSMUST00000146860] [ENSMUST00000211060]
Predicted Effect probably benign
Transcript: ENSMUST00000002011
AA Change: Q4P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002011
Gene: ENSMUSG00000001946
AA Change: Q4P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 39 153 4.82e-6 SMART
IGc2 168 234 1.17e-4 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048604
SMART Domains Protein: ENSMUSP00000043329
Gene: ENSMUSG00000042138

DomainStartEndE-ValueType
low complexity region 46 98 N/A INTRINSIC
Pfam:Myb_DNA-bind_4 101 199 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123198
SMART Domains Protein: ENSMUSP00000116300
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
Blast:IG 9 72 1e-40 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000144596
Predicted Effect probably benign
Transcript: ENSMUST00000146860
SMART Domains Protein: ENSMUSP00000122473
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
IG 9 123 4.82e-6 SMART
IGc2 138 204 1.17e-4 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211060
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhbit a decrease in body weight, impaired neutrophil transmigration and decreased immune and VEGF-stimulated vascular permeability. Tumor growth is inhibited due to decreased pathological angiogenesis in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Esam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03180:Esam APN 9 37534570 missense probably damaging 0.99
IGL03408:Esam APN 9 37534653 missense possibly damaging 0.52
R0755:Esam UTSW 9 37536702 missense probably damaging 0.98
R1657:Esam UTSW 9 37537621 missense probably damaging 1.00
R3418:Esam UTSW 9 37537130 splice site probably null
R4373:Esam UTSW 9 37534196 missense probably benign
R4669:Esam UTSW 9 37536656 nonsense probably null
R6175:Esam UTSW 9 37528248 missense probably benign 0.01
R6357:Esam UTSW 9 37537780 makesense probably null
R7293:Esam UTSW 9 37537724 missense probably damaging 1.00
R7472:Esam UTSW 9 37537567 missense possibly damaging 0.77
R7953:Esam UTSW 9 37537021 missense probably damaging 0.99
R8043:Esam UTSW 9 37537021 missense probably damaging 0.99
R8336:Esam UTSW 9 37537066 missense probably benign 0.37
R8790:Esam UTSW 9 37531631 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGTCCAGTCGGTCTCCAC -3'
(R):5'- GGCAGAAAGTGTAGCACCAACC -3'

Sequencing Primer
(F):5'- AGTCGGTCTCCACCCCAC -3'
(R):5'- GTGTAGCACCAACCAGTGATGTC -3'
Posted On2014-11-11