Incidental Mutation 'R2349:Trip4'
ID247395
Institutional Source Beutler Lab
Gene Symbol Trip4
Ensembl Gene ENSMUSG00000032386
Gene Namethyroid hormone receptor interactor 4
SynonymsASC-1, 4930558E03Rik
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.868) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65828930-65908794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65866562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 246 (D246G)
Ref Sequence ENSEMBL: ENSMUSP00000137304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117083] [ENSMUST00000119245] [ENSMUST00000122410] [ENSMUST00000179395]
Predicted Effect probably benign
Transcript: ENSMUST00000117083
AA Change: D246G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113949
Gene: ENSMUSG00000032386
AA Change: D246G

DomainStartEndE-ValueType
Pfam:zf-C2HC5 168 216 1.7e-14 PFAM
low complexity region 302 322 N/A INTRINSIC
ASCH 437 545 2.63e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119245
AA Change: D246G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112385
Gene: ENSMUSG00000032386
AA Change: D246G

DomainStartEndE-ValueType
Pfam:zf-C2HC5 167 219 8.8e-22 PFAM
low complexity region 302 322 N/A INTRINSIC
ASCH 437 545 2.63e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122410
AA Change: D246G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112866
Gene: ENSMUSG00000032386
AA Change: D246G

DomainStartEndE-ValueType
Pfam:zf-C2HC5 167 219 8e-22 PFAM
low complexity region 302 322 N/A INTRINSIC
ASCH 437 535 3.19e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179395
AA Change: D246G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137304
Gene: ENSMUSG00000032386
AA Change: D246G

DomainStartEndE-ValueType
Pfam:zf-C2HC5 167 219 8e-22 PFAM
low complexity region 302 322 N/A INTRINSIC
ASCH 437 535 3.19e-4 SMART
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the tetrameric nuclear activating signal cointegrator 1 (ASC-1) complex, which associates with transcriptional coactivators, nuclear receptors and basal transcription factors to facilitate nuclear receptors-mediated transcription. This protein is localized in the nucleus and contains an E1A-type zinc finger domain, which mediates interaction with transcriptional coactivators and ligand-bound nuclear receptors, such as thyroid hormone receptor and retinoid X receptor alpha, but not glucocorticoid receptor. Mutations in this gene are associated with spinal muscular atrophy with congenital bone fractures-1 (SMABF1). [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Trip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Trip4 APN 9 65833410 missense probably damaging 1.00
IGL00908:Trip4 APN 9 65874934 missense probably damaging 0.98
IGL01729:Trip4 APN 9 65874892 missense probably benign 0.44
IGL02171:Trip4 APN 9 65881050 missense probably damaging 1.00
IGL03131:Trip4 APN 9 65857445 missense probably benign
R0270:Trip4 UTSW 9 65858358 missense probably damaging 1.00
R0707:Trip4 UTSW 9 65839004 missense possibly damaging 0.95
R0735:Trip4 UTSW 9 65884918 splice site probably benign
R1103:Trip4 UTSW 9 65880906 missense probably benign 0.35
R1436:Trip4 UTSW 9 65880951 missense probably damaging 1.00
R1758:Trip4 UTSW 9 65874977 nonsense probably null
R1831:Trip4 UTSW 9 65858340 missense probably damaging 1.00
R1886:Trip4 UTSW 9 65874881 missense probably null 1.00
R1887:Trip4 UTSW 9 65874881 missense probably null 1.00
R1958:Trip4 UTSW 9 65839025 missense possibly damaging 0.88
R2204:Trip4 UTSW 9 65864265 missense probably damaging 1.00
R3729:Trip4 UTSW 9 65880942 missense possibly damaging 0.87
R3907:Trip4 UTSW 9 65833426 missense probably benign 0.07
R4089:Trip4 UTSW 9 65858283 missense probably benign 0.16
R4879:Trip4 UTSW 9 65875022 missense probably benign 0.00
R4913:Trip4 UTSW 9 65858357 missense probably damaging 1.00
R6127:Trip4 UTSW 9 65866470 critical splice donor site probably null
R6189:Trip4 UTSW 9 65879152 nonsense probably null
R6460:Trip4 UTSW 9 65881020 missense probably damaging 1.00
R7062:Trip4 UTSW 9 65885010 missense probably benign 0.24
R7139:Trip4 UTSW 9 65885221 start gained probably benign
R7180:Trip4 UTSW 9 65857345 missense probably damaging 1.00
R7448:Trip4 UTSW 9 65866475 missense probably damaging 1.00
R7556:Trip4 UTSW 9 65874873 nonsense probably null
R7970:Trip4 UTSW 9 65839016 missense probably damaging 1.00
Z1088:Trip4 UTSW 9 65864415 nonsense probably null
Z1177:Trip4 UTSW 9 65839021 missense probably damaging 1.00
Z1177:Trip4 UTSW 9 65864375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAATCTCTAAACCAATTCCCTGGC -3'
(R):5'- CCATTGATGTCAAACACCACTTGC -3'

Sequencing Primer
(F):5'- CTGGCTCCCCAAATTAAAACATTTG -3'
(R):5'- AAACACCACTTGCTGCTGGTTG -3'
Posted On2014-11-11