Incidental Mutation 'R2349:Jmjd1c'
ID247398
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67255500 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 2520 (M2520T)
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
AA Change: M2519T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: M2519T

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173689
AA Change: M2339T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: M2339T

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173762
Predicted Effect probably benign
Transcript: ENSMUST00000174408
AA Change: M2520T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: M2520T

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
Accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
R7699:Jmjd1c UTSW 10 67218416 missense probably benign 0.10
R7745:Jmjd1c UTSW 10 67217045 missense probably damaging 0.96
R7897:Jmjd1c UTSW 10 67239865 missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67225842 missense probably benign
R7911:Jmjd1c UTSW 10 67231995 missense probably damaging 1.00
R7967:Jmjd1c UTSW 10 67249682 missense probably damaging 1.00
R8058:Jmjd1c UTSW 10 67254495 missense not run
R8224:Jmjd1c UTSW 10 67244849 missense noncoding transcript
R8251:Jmjd1c UTSW 10 67239289 missense noncoding transcript
R8797:Jmjd1c UTSW 10 67224837 missense probably benign
R8833:Jmjd1c UTSW 10 67218383 missense probably benign 0.03
RF011:Jmjd1c UTSW 10 67220199 missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Z1176:Jmjd1c UTSW 10 67238174 missense probably benign
Z1177:Jmjd1c UTSW 10 67238174 missense probably benign
Z1177:Jmjd1c UTSW 10 67246125 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCCTCAATTCCCTTAAAATTAAAGC -3'
(R):5'- ACAGGGGCTGTGGCATAATG -3'

Sequencing Primer
(F):5'- CTCACTTGGGCTACAGTGAAGTC -3'
(R):5'- AGGGGCTGTGGCATAATGCTATAC -3'
Posted On2014-11-11