Incidental Mutation 'R2349:Gpr182'
ID247399
Institutional Source Beutler Lab
Gene Symbol Gpr182
Ensembl Gene ENSMUSG00000058396
Gene NameG protein-coupled receptor 182
SynonymsG10-D, NOW, Gpcr22, Admr, Gpcr17, AM-R
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127747276-127751732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127750937 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 48 (K48N)
Ref Sequence ENSEMBL: ENSMUSP00000100882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054287] [ENSMUST00000079692]
Predicted Effect probably benign
Transcript: ENSMUST00000054287
SMART Domains Protein: ENSMUSP00000052717
Gene: ENSMUSG00000044617

DomainStartEndE-ValueType
BTB 30 126 9.15e-24 SMART
low complexity region 197 206 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 372 394 6.4e0 SMART
ZnF_C2H2 400 420 3.21e1 SMART
ZnF_C2H2 451 474 9.31e1 SMART
ZnF_C2H2 480 502 6.92e0 SMART
ZnF_C2H2 508 530 1.79e-2 SMART
ZnF_C2H2 538 560 1.18e-2 SMART
ZnF_C2H2 605 627 2.57e-3 SMART
ZnF_C2H2 633 655 3.78e-1 SMART
ZnF_C2H2 661 683 2.49e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079692
AA Change: K48N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100882
Gene: ENSMUSG00000058396
AA Change: K48N

DomainStartEndE-ValueType
Pfam:7tm_1 66 316 1.2e-40 PFAM
low complexity region 340 352 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Gpr182
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Gpr182 APN 10 127750690 missense probably benign 0.09
IGL00983:Gpr182 APN 10 127750788 missense possibly damaging 0.89
IGL01337:Gpr182 APN 10 127750786 missense possibly damaging 0.95
IGL01810:Gpr182 APN 10 127750864 missense probably damaging 1.00
R0449:Gpr182 UTSW 10 127750696 missense probably damaging 1.00
R0554:Gpr182 UTSW 10 127751071 missense probably benign 0.00
R2229:Gpr182 UTSW 10 127750141 missense possibly damaging 0.91
R2292:Gpr182 UTSW 10 127750182 missense possibly damaging 0.89
R2445:Gpr182 UTSW 10 127750627 missense probably benign 0.01
R5977:Gpr182 UTSW 10 127750879 missense possibly damaging 0.79
R6290:Gpr182 UTSW 10 127751024 missense probably benign 0.00
R6415:Gpr182 UTSW 10 127750506 missense possibly damaging 0.88
R8014:Gpr182 UTSW 10 127751005 missense possibly damaging 0.59
R8093:Gpr182 UTSW 10 127750914 missense probably damaging 1.00
R8333:Gpr182 UTSW 10 127749921 missense probably benign 0.08
R8543:Gpr182 UTSW 10 127750992 missense probably benign 0.43
R8788:Gpr182 UTSW 10 127750660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGTACATGTTGACAAGGTAG -3'
(R):5'- TCCAACAGACCCAAGTTGGC -3'

Sequencing Primer
(F):5'- GAGCCAAGTGTACTCCAGCATG -3'
(R):5'- AAGTTGGCCCTCATGTCAG -3'
Posted On2014-11-11