Incidental Mutation 'R2349:Pex13'
ID247401
Institutional Source Beutler Lab
Gene Symbol Pex13
Ensembl Gene ENSMUSG00000020283
Gene Nameperoxisomal biogenesis factor 13
Synonyms
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23646479-23665959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23655789 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 147 (M147T)
Ref Sequence ENSEMBL: ENSMUSP00000020523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020523] [ENSMUST00000130811]
PDB Structure Solution structure of the SH3 domain of mouse peroxisomal biogenesis factor 13 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000020523
AA Change: M147T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020523
Gene: ENSMUSG00000020283
AA Change: M147T

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:Peroxin-13_N 101 256 3.6e-51 PFAM
SH3 277 337 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124839
Predicted Effect probably benign
Transcript: ENSMUST00000130811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146533
Meta Mutation Damage Score 0.5686 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peroxisomal membrane protein that binds the type 1 peroxisomal targeting signal receptor via a SH3 domain located in the cytoplasm. Mutations and deficiencies in peroxisomal protein importing and peroxisome assembly lead to peroxisomal biogenesis disorders, an example of which is Zellweger syndrome. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted disruption of this gene results in intrauterine growth retardation, hypotonia, aphagia, abnormal lamination of the cerebral cortex associated with a neuronal migration defect, liver steatosis, delayed differentiation of renal glomeruli, impairedperoxisome metabolism, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Pex13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Pex13 APN 11 23656111 missense probably benign
Pitch UTSW 11 23655949 missense probably benign
yaw UTSW 11 23649527 missense possibly damaging 0.58
R0455:Pex13 UTSW 11 23655949 missense probably benign
R0671:Pex13 UTSW 11 23665831 missense possibly damaging 0.57
R1454:Pex13 UTSW 11 23649422 missense probably benign
R1738:Pex13 UTSW 11 23649458 missense probably benign
R1830:Pex13 UTSW 11 23655513 missense probably damaging 0.96
R4688:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R5094:Pex13 UTSW 11 23655441 missense probably benign 0.00
R5727:Pex13 UTSW 11 23655705 missense probably benign 0.02
R6360:Pex13 UTSW 11 23655690 missense probably benign 0.17
R6837:Pex13 UTSW 11 23649527 missense possibly damaging 0.58
R6957:Pex13 UTSW 11 23655628 missense probably benign
R7167:Pex13 UTSW 11 23655472 missense possibly damaging 0.69
R7880:Pex13 UTSW 11 23649369 missense probably benign 0.26
R7898:Pex13 UTSW 11 23650929 critical splice donor site probably null
R8000:Pex13 UTSW 11 23655915 missense probably damaging 1.00
R8284:Pex13 UTSW 11 23655685 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGGTCCTCATTCTCAGAGCC -3'
(R):5'- CATTTTCTTCTGGATATGGAGCC -3'

Sequencing Primer
(F):5'- AGAGCCTCTTCTTAAACCCATC -3'
(R):5'- TCTGGATATGGAGCCTACGGAAATTC -3'
Posted On2014-11-11