Incidental Mutation 'R2349:Krt222'
ID247403
Institutional Source Beutler Lab
Gene Symbol Krt222
Ensembl Gene ENSMUSG00000035849
Gene Namekeratin 222
Synonyms
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2349 (G1)
Quality Score204
Status Validated
Chromosome11
Chromosomal Location99232761-99244085 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 99238765 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038214] [ENSMUST00000103132]
Predicted Effect probably benign
Transcript: ENSMUST00000038214
SMART Domains Protein: ENSMUSP00000044561
Gene: ENSMUSG00000035849

DomainStartEndE-ValueType
Pfam:Filament 1 109 7.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103132
SMART Domains Protein: ENSMUSP00000099421
Gene: ENSMUSG00000035849

DomainStartEndE-ValueType
Pfam:Filament 1 149 2.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154622
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Krt222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03377:Krt222 APN 11 99236513 nonsense probably null
R0581:Krt222 UTSW 11 99236192 nonsense probably null
R0674:Krt222 UTSW 11 99236260 missense probably benign 0.37
R5073:Krt222 UTSW 11 99243970 start gained probably benign
R5478:Krt222 UTSW 11 99234948 missense probably damaging 1.00
R5512:Krt222 UTSW 11 99234955 missense probably damaging 1.00
R6244:Krt222 UTSW 11 99235058 splice site probably null
Z1176:Krt222 UTSW 11 99238552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTCGTGTTGAGAAGCATC -3'
(R):5'- GTCCTCCTGAATACCTGAAGCAC -3'

Sequencing Primer
(F):5'- TGACTCCAGATCTTGCAG -3'
(R):5'- CAAAGAAGGTGGAGCTATAGGTG -3'
Posted On2014-11-11