Incidental Mutation 'R2349:Nkx2-9'
ID247405
Institutional Source Beutler Lab
Gene Symbol Nkx2-9
Ensembl Gene ENSMUSG00000058669
Gene NameNK2 homeobox 9
SynonymsNkx2.9, Nkx-2.9, tinman
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2349 (G1)
Quality Score105
Status Validated
Chromosome12
Chromosomal Location56611389-56613284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56612222 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 69 (L69P)
Ref Sequence ENSEMBL: ENSMUSP00000072425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072631]
Predicted Effect probably benign
Transcript: ENSMUST00000072631
AA Change: L69P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072425
Gene: ENSMUSG00000058669
AA Change: L69P

DomainStartEndE-ValueType
HOX 81 143 5.04e-23 SMART
low complexity region 162 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191707
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a homeobox-containing developmental regulator associated with liver development. The encoded protein binds to the alpha-fetoprotein (AFP) gene promoter and increases the expression of AFP. This gene is overexpressed in some lung cancers and is linked to poor patient survival, possibly due to its resistance to cisplatin. This gene is aberrantly methylated in pancreatic cancer, deleted in squamous cell lung carcinomas, and acts as a tumor suppressor in esophageal cancer. Mutations in this gene may also be a cause of neural tube defects. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutant mice lacking both functional copies of the gene are viable and fertile but display abnormal development of the spinal accessory nerve. Another mutant exhibits progressive bronchial dysplasia leading to lung cancer in aged mutants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rac2 A G 15: 78,565,475 V85A possibly damaging Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Nkx2-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Nkx2-9 APN 12 56611920 missense probably damaging 1.00
R1633:Nkx2-9 UTSW 12 56612981 missense probably benign 0.01
R6663:Nkx2-9 UTSW 12 56611938 missense probably benign 0.12
R6872:Nkx2-9 UTSW 12 56611889 missense probably benign
R7804:Nkx2-9 UTSW 12 56612132 missense probably damaging 1.00
R7898:Nkx2-9 UTSW 12 56612246 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCAGATCAGATGATGCTGCC -3'
(R):5'- AGCAAGAGAATTGGGACTCC -3'

Sequencing Primer
(F):5'- TGATGCTGCCATATCCGAAG -3'
(R):5'- GAATTGGGACTCCAGGTGG -3'
Posted On2014-11-11