Incidental Mutation 'R2349:Rac2'
ID247406
Institutional Source Beutler Lab
Gene Symbol Rac2
Ensembl Gene ENSMUSG00000033220
Gene NameRac family small GTPase 2
Synonyms
MMRRC Submission 040331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2349 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78559167-78572783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78565475 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 85 (V85A)
Ref Sequence ENSEMBL: ENSMUSP00000036384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043214] [ENSMUST00000229394]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043214
AA Change: V85A

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: V85A

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229394
Predicted Effect probably benign
Transcript: ENSMUST00000230952
Meta Mutation Damage Score 0.1423 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,652,378 K77E probably damaging Het
Arfgef2 T A 2: 166,852,028 I507N probably damaging Het
Atg16l2 T C 7: 101,296,539 K231E probably damaging Het
C1s1 C A 6: 124,541,473 probably benign Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cntrl A G 2: 35,176,251 T1739A probably benign Het
Col15a1 G A 4: 47,306,742 M289I probably damaging Het
Crebbp G A 16: 4,138,910 R350C probably damaging Het
Dbx2 A G 15: 95,624,959 V289A probably benign Het
Esam A C 9: 37,528,231 Q4P probably benign Het
Galnt1 A G 18: 24,280,028 M462V probably benign Het
Got1l1 T C 8: 27,197,931 T357A probably benign Het
Gpr182 T A 10: 127,750,937 K48N probably damaging Het
Hdlbp A G 1: 93,422,234 probably benign Het
Ifi209 G A 1: 173,642,556 V237M probably damaging Het
Igf2r A T 17: 12,722,311 probably null Het
Jmjd1c T C 10: 67,255,500 M2520T probably benign Het
Krt222 A G 11: 99,238,765 probably benign Het
Nkx2-9 A G 12: 56,612,222 L69P probably benign Het
Papss1 A G 3: 131,599,866 D203G probably benign Het
Pex13 A G 11: 23,655,789 M147T probably damaging Het
Pkd1l1 A T 11: 8,826,819 probably null Het
Rock2 A G 12: 16,977,615 N127S probably benign Het
Sfswap C T 5: 129,569,738 R875C possibly damaging Het
Slco5a1 C T 1: 12,921,152 V438M probably damaging Het
Thsd4 A G 9: 59,972,515 Y620H probably benign Het
Trip4 T C 9: 65,866,562 D246G probably benign Het
Usp10 T C 8: 119,956,709 *88R probably null Het
Vars A G 17: 35,015,752 I1186V probably benign Het
Vps13c A G 9: 67,957,526 D3039G possibly damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Xpo6 A T 7: 126,113,703 V701E probably benign Het
Other mutations in Rac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Lamb UTSW 15 78564934 missense possibly damaging 0.68
Potter UTSW 15 78570743 nonsense probably null
Potter2 UTSW 15 78565454 missense probably damaging 0.97
wheel UTSW 15 78566006 missense probably benign 0.29
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5051:Rac2 UTSW 15 78564934 missense possibly damaging 0.68
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
R7384:Rac2 UTSW 15 78561931 nonsense probably null
R8482:Rac2 UTSW 15 78566006 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AAGAGTCAAGCGAGTTTGTGTG -3'
(R):5'- AGCCTTTCTCAGTGTGTGCC -3'

Sequencing Primer
(F):5'- TTGTGTGTTGATAAGAAGAGGCAC -3'
(R):5'- TCTCAGTGTGTGCCAGGCAG -3'
Posted On2014-11-11