Mutagenetix > Incidental Mutations

Incidental Mutation 'R2349:Dbx2'

247407

Institutional Source

Beutler Lab

Gene Symbol

Dbx2

Ensembl Gene

ENSMUSG00000045608

Gene Name

developing brain homeobox 2

Synonyms

LOC383001, 9430056A22Rik

MMRRC Submission

040331-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R2349 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95623563-95655960 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 95624959 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 289 (V289A)

Ref Sequence

ENSEMBL: ENSMUSP00000060424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054244]

Predicted Effect

probably benign
Transcript: ENSMUST00000054244
AA Change: V289A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000060424
Gene: ENSMUSG00000045608
AA Change: V289A

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	108	125	N/A	INTRINSIC
HOX	226	288	3.11e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229611

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (34/34)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	C	8: 43,652,378	K77E	probably damaging	Het
Arfgef2	T	A	2: 166,852,028	I507N	probably damaging	Het
Atg16l2	T	C	7: 101,296,539	K231E	probably damaging	Het
C1s1	C	A	6: 124,541,473		probably benign	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Cntrl	A	G	2: 35,176,251	T1739A	probably benign	Het
Col15a1	G	A	4: 47,306,742	M289I	probably damaging	Het
Crebbp	G	A	16: 4,138,910	R350C	probably damaging	Het
Esam	A	C	9: 37,528,231	Q4P	probably benign	Het
Galnt1	A	G	18: 24,280,028	M462V	probably benign	Het
Got1l1	T	C	8: 27,197,931	T357A	probably benign	Het
Gpr182	T	A	10: 127,750,937	K48N	probably damaging	Het
Hdlbp	A	G	1: 93,422,234		probably benign	Het
Ifi209	G	A	1: 173,642,556	V237M	probably damaging	Het
Igf2r	A	T	17: 12,722,311		probably null	Het
Jmjd1c	T	C	10: 67,255,500	M2520T	probably benign	Het
Krt222	A	G	11: 99,238,765		probably benign	Het
Nkx2-9	A	G	12: 56,612,222	L69P	probably benign	Het
Papss1	A	G	3: 131,599,866	D203G	probably benign	Het
Pex13	A	G	11: 23,655,789	M147T	probably damaging	Het
Pkd1l1	A	T	11: 8,826,819		probably null	Het
Rac2	A	G	15: 78,565,475	V85A	possibly damaging	Het
Rock2	A	G	12: 16,977,615	N127S	probably benign	Het
Sfswap	C	T	5: 129,569,738	R875C	possibly damaging	Het
Slco5a1	C	T	1: 12,921,152	V438M	probably damaging	Het
Thsd4	A	G	9: 59,972,515	Y620H	probably benign	Het
Trip4	T	C	9: 65,866,562	D246G	probably benign	Het
Usp10	T	C	8: 119,956,709	*88R	probably null	Het
Vars	A	G	17: 35,015,752	I1186V	probably benign	Het
Vps13c	A	G	9: 67,957,526	D3039G	possibly damaging	Het
Wwp1	A	T	4: 19,638,644	N566K	possibly damaging	Het
Xpo6	A	T	7: 126,113,703	V701E	probably benign	Het

Other mutations in Dbx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02245:Dbx2	APN	15	95624747	missense	probably damaging	1.00
IGL02747:Dbx2	APN	15	95632439	missense	probably benign	0.06
R0610:Dbx2	UTSW	15	95624897	missense	probably benign	0.01
R0646:Dbx2	UTSW	15	95654612	missense	possibly damaging	0.53
R1411:Dbx2	UTSW	15	95632381	missense	probably damaging	0.98
R1770:Dbx2	UTSW	15	95624734	missense	probably benign	0.11
R1978:Dbx2	UTSW	15	95632353	missense	probably damaging	0.99
R2118:Dbx2	UTSW	15	95624800	missense	probably damaging	1.00
R3899:Dbx2	UTSW	15	95632432	missense	possibly damaging	0.81
R5368:Dbx2	UTSW	15	95640641	missense	probably benign	0.09
R5734:Dbx2	UTSW	15	95654723	missense	possibly damaging	0.53
R6726:Dbx2	UTSW	15	95624860	missense	possibly damaging	0.64
R6843:Dbx2	UTSW	15	95654459	missense	possibly damaging	0.91
R7962:Dbx2	UTSW	15	95654318	missense	probably benign	0.36
R8490:Dbx2	UTSW	15	95654573	missense	possibly damaging	0.59
R8845:Dbx2	UTSW	15	95654636	missense	probably benign	0.01
R8865:Dbx2	UTSW	15	95632400	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGGGTCAGTCTTTCTGCAG -3'
(R):5'- TTCCAGAGTAGGAGATTCTGCAG -3'

Sequencing Primer
(F):5'- CTGCAGATTCTGGAGTCTCC -3'
(R):5'- TCTGCAGTAAGTATAGTCGAAGC -3'

Posted On

2014-11-11