Incidental Mutation 'R0288:Cyfip2'
ID24741
Institutional Source Beutler Lab
Gene Symbol Cyfip2
Ensembl Gene ENSMUSG00000020340
Gene Namecytoplasmic FMR1 interacting protein 2
Synonyms1500004I01Rik, Pir121, 6430511D02Rik
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46193850-46312859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46253972 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 685 (F685S)
Ref Sequence ENSEMBL: ENSMUSP00000127586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093165
AA Change: F685S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: F685S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 303 5.4e-12 PFAM
Pfam:FragX_IP 388 1221 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093166
AA Change: F685S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: F685S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Predicted Effect unknown
Transcript: ENSMUST00000142017
AA Change: F379S
SMART Domains Protein: ENSMUSP00000119801
Gene: ENSMUSG00000020340
AA Change: F379S

DomainStartEndE-ValueType
Pfam:FragX_IP 58 230 4e-66 PFAM
Pfam:FragX_IP 246 916 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165599
AA Change: F685S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: F685S

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Meta Mutation Damage Score 0.9729 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Cyfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cyfip2 APN 11 46200685 missense possibly damaging 0.74
IGL01352:Cyfip2 APN 11 46265996 missense probably benign 0.01
IGL01685:Cyfip2 APN 11 46207488 splice site probably benign
IGL02367:Cyfip2 APN 11 46276905 nonsense probably null
IGL02390:Cyfip2 APN 11 46221398 missense possibly damaging 0.58
IGL02471:Cyfip2 APN 11 46200803 missense possibly damaging 0.58
IGL02583:Cyfip2 APN 11 46249758 missense possibly damaging 0.56
IGL03199:Cyfip2 APN 11 46276843 missense probably benign 0.07
IGL02835:Cyfip2 UTSW 11 46249771 missense probably benign 0.00
R0081:Cyfip2 UTSW 11 46253998 nonsense probably null
R1830:Cyfip2 UTSW 11 46199019 missense probably damaging 1.00
R1869:Cyfip2 UTSW 11 46224168 missense probably benign 0.40
R1989:Cyfip2 UTSW 11 46253998 nonsense probably null
R2045:Cyfip2 UTSW 11 46249789 missense probably benign 0.00
R2101:Cyfip2 UTSW 11 46242443 missense probably damaging 1.00
R2131:Cyfip2 UTSW 11 46286131 missense possibly damaging 0.78
R2162:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R2299:Cyfip2 UTSW 11 46286131 missense probably benign 0.02
R3831:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3832:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3833:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3881:Cyfip2 UTSW 11 46208335 missense probably damaging 1.00
R4127:Cyfip2 UTSW 11 46270647 missense probably benign 0.00
R4385:Cyfip2 UTSW 11 46242403 missense probably benign 0.05
R4617:Cyfip2 UTSW 11 46254018 missense probably damaging 1.00
R4739:Cyfip2 UTSW 11 46279993 missense probably damaging 0.99
R5232:Cyfip2 UTSW 11 46242378 missense probably damaging 1.00
R5365:Cyfip2 UTSW 11 46247630 missense probably damaging 0.99
R5383:Cyfip2 UTSW 11 46278091 missense possibly damaging 0.83
R5447:Cyfip2 UTSW 11 46291586 missense possibly damaging 0.72
R5450:Cyfip2 UTSW 11 46284252 missense probably benign 0.00
R5796:Cyfip2 UTSW 11 46198996 missense probably benign 0.01
R5820:Cyfip2 UTSW 11 46200704 missense probably damaging 1.00
R5925:Cyfip2 UTSW 11 46207436 missense probably damaging 1.00
R6143:Cyfip2 UTSW 11 46253965 nonsense probably null
R6321:Cyfip2 UTSW 11 46291520 missense probably benign 0.01
R6502:Cyfip2 UTSW 11 46221346 missense probably damaging 1.00
R6511:Cyfip2 UTSW 11 46196308 missense probably benign 0.00
R6521:Cyfip2 UTSW 11 46254588 missense probably damaging 1.00
R6660:Cyfip2 UTSW 11 46249807 missense possibly damaging 0.89
R6836:Cyfip2 UTSW 11 46272640 missense probably benign 0.16
R6866:Cyfip2 UTSW 11 46242459 nonsense probably null
R7062:Cyfip2 UTSW 11 46260832 missense probably damaging 1.00
R7192:Cyfip2 UTSW 11 46254666 missense probably benign 0.21
R7231:Cyfip2 UTSW 11 46224136 missense probably benign
R7258:Cyfip2 UTSW 11 46224177 missense probably benign 0.02
R7365:Cyfip2 UTSW 11 46207440 nonsense probably null
R7441:Cyfip2 UTSW 11 46196427 missense possibly damaging 0.80
R7561:Cyfip2 UTSW 11 46270598 missense probably benign 0.00
R7831:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7871:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
R7914:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7954:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
Z1176:Cyfip2 UTSW 11 46222615 missense not run
Z1177:Cyfip2 UTSW 11 46222615 missense not run
Predicted Primers PCR Primer
(F):5'- ACATGAAGGTCCTTGAAGCCCCTC -3'
(R):5'- AGCTTGTCTTCAACTCCAAGCCATC -3'

Sequencing Primer
(F):5'- CTTGAAGCCCCTCATGGTGTAG -3'
(R):5'- AAGCCATCTGCCTCATCACTC -3'
Posted On2013-04-16