Mutagenetix > Incidental Mutation

Incidental Mutation 'R2357:Tbx15'

247423

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

040339-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R2357 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

splice site (3291 bp from exon)

DNA Base Change (assembly)

C to T at 99316356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

probably null
Transcript: ENSMUST00000029462
AA Change: Q287*

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Q287*

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000150756

SMART Domains

Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
TBOX	6	142	2.4e-72	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	C	A	2: 68,739,500	T520K	possibly damaging	Het
9130204L05Rik	A	T	3: 91,088,426	S56R	probably benign	Het
Abca13	T	C	11: 9,297,336	L2361P	probably damaging	Het
Acsl6	T	A	11: 54,327,280	M248K	probably damaging	Het
Adam11	G	T	11: 102,774,508	V467L	probably benign	Het
Afap1	C	T	5: 35,984,274	H501Y	probably damaging	Het
Ankrd28	A	T	14: 31,764,294	Y22*	probably null	Het
Ccdc124	A	T	8: 70,868,535	L187Q	probably damaging	Het
Cdc42bpa	G	A	1: 180,067,227	S324N	possibly damaging	Het
Cgnl1	T	A	9: 71,725,668	K134*	probably null	Het
Cnpy3	G	T	17: 46,751,983	S47R	probably damaging	Het
Cpne8	A	T	15: 90,619,674	L96Q	probably damaging	Het
Crisp3	A	T	17: 40,222,505	Y212N	probably damaging	Het
Cryba1	A	T	11: 77,722,601		probably benign	Het
Cyc1	A	G	15: 76,345,566	M288V	possibly damaging	Het
Dnah8	T	A	17: 30,771,872	D3296E	probably benign	Het
Dnah8	A	G	17: 30,874,935	T4668A	probably benign	Het
Dnajb6	T	A	5: 29,753,640	F113I	probably damaging	Het
Dync2h1	A	G	9: 7,081,053	I2881T	probably benign	Het
Eps8l1	T	C	7: 4,470,355	S179P	probably benign	Het
Esco2	C	A	14: 65,826,551	A395S	probably benign	Het
Evi5l	T	C	8: 4,193,113		probably benign	Het
Exoc6b	T	C	6: 84,989,339	T218A	possibly damaging	Het
Gde1	A	T	7: 118,691,591	F170L	probably benign	Het
Ggt5	A	C	10: 75,609,241	I361L	probably benign	Het
Golga3	C	T	5: 110,202,648	T683M	probably damaging	Het
Golgb1	A	G	16: 36,912,008	Q539R	probably damaging	Het
Grm2	A	G	9: 106,647,581	V645A	probably damaging	Het
Gtf2h4	A	T	17: 35,667,999	V408D	probably damaging	Het
Gucy1a2	A	T	9: 3,797,299	H583L	probably damaging	Het
Hivep2	C	T	10: 14,143,299	A1938V	probably benign	Het
Iars	T	C	13: 49,688,203	Y56H	probably damaging	Het
Il17re	A	G	6: 113,468,470	I381V	possibly damaging	Het
Klrd1	T	A	6: 129,596,909	*71K	probably null	Het
Kng1	A	T	16: 23,079,065	Y405F	possibly damaging	Het
Kptn	G	T	7: 16,125,784	C311F	probably damaging	Het
Lama5	T	C	2: 180,180,097	I2982V	probably benign	Het
Mamstr	G	T	7: 45,642,330	D35Y	probably damaging	Het
Mdc1	A	G	17: 35,847,445	D239G	probably benign	Het
Mindy3	T	G	2: 12,404,176		probably benign	Het
Mrpl39	A	T	16: 84,727,564	H204Q	probably benign	Het
Myo16	G	A	8: 10,594,905	D1746N	possibly damaging	Het
Myo5a	T	A	9: 75,201,365	M1476K	probably damaging	Het
Nol4	A	G	18: 23,039,910	S45P	probably benign	Het
Nol8	T	C	13: 49,654,504		probably null	Het
Olfr1314	A	G	2: 112,092,398	I101T	possibly damaging	Het
Olfr73	A	T	2: 88,034,684	W152R	probably damaging	Het
Olfr777	C	A	10: 129,268,773	K183N	probably benign	Het
Olfr923	T	C	9: 38,828,338	S216P	probably benign	Het
Plau	T	A	14: 20,838,615	V100D	probably damaging	Het
Plpp7	T	C	2: 32,109,642	V6A	probably benign	Het
Prr14	T	C	7: 127,475,363	S356P	probably benign	Het
Rabl3	A	G	16: 37,541,931	D44G	probably null	Het
Rasa4	T	C	5: 136,091,247	V59A	probably damaging	Het
Rbm46	A	T	3: 82,864,458	D283E	probably benign	Het
Rictor	A	T	15: 6,783,562	N932I	probably damaging	Het
Rpl9-ps6	A	G	19: 32,466,343	V70A	probably benign	Het
St3gal1	A	G	15: 67,113,782	Y8H	probably benign	Het
Strn	G	A	17: 78,655,599	T745I	probably damaging	Het
Tbx20	T	A	9: 24,769,776	D140V	possibly damaging	Het
Ttn	A	C	2: 76,836,579	Y42*	probably null	Het
Usp9y	G	A	Y: 1,394,050	T560I	possibly damaging	Het
Vmn2r111	A	G	17: 22,559,170		probably benign	Het
Vps13d	GG	GGGGGG	4: 145,074,977		probably null	Het
Wfdc12	A	T	2: 164,190,250	I40N	probably damaging	Het
Zfp78	G	A	7: 6,379,057	G369R	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99351912	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGCCCAGCCTAAACTTTC -3'
(R):5'- GTGCTATAAGACTGGTCTCTCC -3'

Sequencing Primer
(F):5'- GCCCAGCCTAAACTTTCCTCTTTG -3'
(R):5'- ATCATGGACCCTGAATGGATCTG -3'

Posted On

2014-11-11