Incidental Mutation 'R2357:Tbx15'
ID 247423
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 040339-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R2357 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation splice site (3291 bp from exon)
DNA Base Change (assembly) C to T at 99223672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000150756] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect probably null
Transcript: ENSMUST00000029462
AA Change: Q287*
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: Q287*

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150756
SMART Domains Protein: ENSMUSP00000142358
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
TBOX 6 142 2.4e-72 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,569,844 (GRCm39) T520K possibly damaging Het
Abca13 T C 11: 9,247,336 (GRCm39) L2361P probably damaging Het
Acsl6 T A 11: 54,218,106 (GRCm39) M248K probably damaging Het
Adam11 G T 11: 102,665,334 (GRCm39) V467L probably benign Het
Afap1 C T 5: 36,141,618 (GRCm39) H501Y probably damaging Het
Ankrd28 A T 14: 31,486,251 (GRCm39) Y22* probably null Het
Ccdc124 A T 8: 71,321,179 (GRCm39) L187Q probably damaging Het
Cdc42bpa G A 1: 179,894,792 (GRCm39) S324N possibly damaging Het
Cgnl1 T A 9: 71,632,950 (GRCm39) K134* probably null Het
Cnpy3 G T 17: 47,062,909 (GRCm39) S47R probably damaging Het
Cpne8 A T 15: 90,503,877 (GRCm39) L96Q probably damaging Het
Crisp3 A T 17: 40,533,396 (GRCm39) Y212N probably damaging Het
Cryba1 A T 11: 77,613,427 (GRCm39) probably benign Het
Cyc1 A G 15: 76,229,766 (GRCm39) M288V possibly damaging Het
Dnah8 T A 17: 30,990,846 (GRCm39) D3296E probably benign Het
Dnah8 A G 17: 31,093,909 (GRCm39) T4668A probably benign Het
Dnajb6 T A 5: 29,958,638 (GRCm39) F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 (GRCm39) I2881T probably benign Het
Eps8l1 T C 7: 4,473,354 (GRCm39) S179P probably benign Het
Esco2 C A 14: 66,064,000 (GRCm39) A395S probably benign Het
Evi5l T C 8: 4,243,113 (GRCm39) probably benign Het
Exoc6b T C 6: 84,966,321 (GRCm39) T218A possibly damaging Het
Gde1 A T 7: 118,290,814 (GRCm39) F170L probably benign Het
Ggt5 A C 10: 75,445,075 (GRCm39) I361L probably benign Het
Golga3 C T 5: 110,350,514 (GRCm39) T683M probably damaging Het
Golgb1 A G 16: 36,732,370 (GRCm39) Q539R probably damaging Het
Grm2 A G 9: 106,524,780 (GRCm39) V645A probably damaging Het
Gtf2h4 A T 17: 35,978,891 (GRCm39) V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 (GRCm39) H583L probably damaging Het
Hivep2 C T 10: 14,019,043 (GRCm39) A1938V probably benign Het
Iars1 T C 13: 49,841,679 (GRCm39) Y56H probably damaging Het
Il17re A G 6: 113,445,431 (GRCm39) I381V possibly damaging Het
Klrd1 T A 6: 129,573,872 (GRCm39) *71K probably null Het
Kng1 A T 16: 22,897,815 (GRCm39) Y405F possibly damaging Het
Kptn G T 7: 15,859,709 (GRCm39) C311F probably damaging Het
Lama5 T C 2: 179,821,890 (GRCm39) I2982V probably benign Het
Mamstr G T 7: 45,291,754 (GRCm39) D35Y probably damaging Het
Mdc1 A G 17: 36,158,337 (GRCm39) D239G probably benign Het
Mindy3 T G 2: 12,408,987 (GRCm39) probably benign Het
Mrpl39 A T 16: 84,524,452 (GRCm39) H204Q probably benign Het
Myo16 G A 8: 10,644,905 (GRCm39) D1746N possibly damaging Het
Myo5a T A 9: 75,108,647 (GRCm39) M1476K probably damaging Het
Nol4 A G 18: 23,172,967 (GRCm39) S45P probably benign Het
Nol8 T C 13: 49,807,980 (GRCm39) probably null Het
Or4f61 A G 2: 111,922,743 (GRCm39) I101T possibly damaging Het
Or5d18 A T 2: 87,865,028 (GRCm39) W152R probably damaging Het
Or6c207 C A 10: 129,104,642 (GRCm39) K183N probably benign Het
Or8b56 T C 9: 38,739,634 (GRCm39) S216P probably benign Het
Plau T A 14: 20,888,683 (GRCm39) V100D probably damaging Het
Plpp7 T C 2: 31,999,654 (GRCm39) V6A probably benign Het
Prr14 T C 7: 127,074,535 (GRCm39) S356P probably benign Het
Rabl3 A G 16: 37,362,293 (GRCm39) D44G probably null Het
Rasa4 T C 5: 136,120,101 (GRCm39) V59A probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Rictor A T 15: 6,813,043 (GRCm39) N932I probably damaging Het
Rpl9-ps6 A G 19: 32,443,743 (GRCm39) V70A probably benign Het
S100a7l2 A T 3: 90,995,733 (GRCm39) S56R probably benign Het
St3gal1 A G 15: 66,985,631 (GRCm39) Y8H probably benign Het
Strn G A 17: 78,963,028 (GRCm39) T745I probably damaging Het
Tbx20 T A 9: 24,681,072 (GRCm39) D140V possibly damaging Het
Ttn A C 2: 76,666,923 (GRCm39) Y42* probably null Het
Usp9y G A Y: 1,394,050 (GRCm39) T560I possibly damaging Het
Vmn2r111 A G 17: 22,778,151 (GRCm39) probably benign Het
Vps13d GG GGGGGG 4: 144,801,547 (GRCm39) probably null Het
Wfdc12 A T 2: 164,032,170 (GRCm39) I40N probably damaging Het
Zfp78 G A 7: 6,382,056 (GRCm39) G369R probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCCCAGCCTAAACTTTC -3'
(R):5'- GTGCTATAAGACTGGTCTCTCC -3'

Sequencing Primer
(F):5'- GCCCAGCCTAAACTTTCCTCTTTG -3'
(R):5'- ATCATGGACCCTGAATGGATCTG -3'
Posted On 2014-11-11