Incidental Mutation 'R2357:Golga3'
ID247428
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2357 (G1)
Quality Score201
Status Validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110202648 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 683 (T683M)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect probably damaging
Transcript: ENSMUST00000031477
AA Change: T723M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: T723M

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112512
AA Change: T683M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: T683M

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2495:Golga3 UTSW 5 110207596 missense probably damaging 0.99
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCCTGATCATGGGTTTGC -3'
(R):5'- GATTGTAGAGCCACTTCCAAGAC -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- CAAGACAATCTTCTCATTCTGCAAG -3'
Posted On2014-11-11