Incidental Mutation 'R0288:Coil'
ID24743
Institutional Source Beutler Lab
Gene Symbol Coil
Ensembl Gene ENSMUSG00000033983
Gene Namecoilin
SynonymsCln80, p80-coilin
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0288 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88970252-88991613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88981868 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 352 (G352R)
Ref Sequence ENSEMBL: ENSMUSP00000103530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]
Predicted Effect probably damaging
Transcript: ENSMUST00000036649
AA Change: G352R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: G352R

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 161 167 N/A INTRINSIC
low complexity region 174 195 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 401 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107898
AA Change: G352R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: G352R

DomainStartEndE-ValueType
Pfam:Coilin_N 10 220 8.7e-35 PFAM
low complexity region 303 325 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Coil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Coil APN 11 88981754 missense probably benign 0.02
PIT4519001:Coil UTSW 11 88972726 start gained probably benign
PIT4520001:Coil UTSW 11 88981611 missense probably benign 0.01
R0122:Coil UTSW 11 88985007 splice site probably benign
R0211:Coil UTSW 11 88982153 missense probably damaging 1.00
R0396:Coil UTSW 11 88981623 missense probably benign
R0416:Coil UTSW 11 88981986 missense possibly damaging 0.55
R1251:Coil UTSW 11 88982299 missense possibly damaging 0.93
R1481:Coil UTSW 11 88974060 missense possibly damaging 0.87
R1705:Coil UTSW 11 88974136 missense probably damaging 1.00
R1728:Coil UTSW 11 88973976 missense probably damaging 0.98
R1824:Coil UTSW 11 88982097 missense possibly damaging 0.91
R2989:Coil UTSW 11 88987979 missense probably damaging 1.00
R3819:Coil UTSW 11 88981793 missense probably benign 0.07
R5217:Coil UTSW 11 88981161 missense possibly damaging 0.94
R6997:Coil UTSW 11 88981847 missense probably benign
R7050:Coil UTSW 11 88981188 missense possibly damaging 0.87
RF007:Coil UTSW 11 88981830 small deletion probably benign
Z1176:Coil UTSW 11 88981976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGATGCACCTGCTACCAAGAC -3'
(R):5'- TAAAGACACAGGAGACCGCTTGCC -3'

Sequencing Primer
(F):5'- AGCTGCCAACAGGCAGG -3'
(R):5'- CCATCCTCTTCCCAAACTGG -3'
Posted On2013-04-16