Incidental Mutation 'R2357:Il17re'
ID247431
Institutional Source Beutler Lab
Gene Symbol Il17re
Ensembl Gene ENSMUSG00000043088
Gene Nameinterleukin 17 receptor E
SynonymsIl25r
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2357 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113458484-113470758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113468470 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 381 (I381V)
Ref Sequence ENSEMBL: ENSMUSP00000145384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053569] [ENSMUST00000058300] [ENSMUST00000058548] [ENSMUST00000101065] [ENSMUST00000203281] [ENSMUST00000203661] [ENSMUST00000204774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053569
AA Change: I180V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054378
Gene: ENSMUSG00000043088
AA Change: I180V

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058300
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000058548
AA Change: I381V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062103
Gene: ENSMUSG00000043088
AA Change: I381V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 6.2e-121 PFAM
transmembrane domain 415 437 N/A INTRINSIC
Pfam:SEFIR 448 585 1.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101065
AA Change: I180V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098626
Gene: ENSMUSG00000043088
AA Change: I180V

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203281
SMART Domains Protein: ENSMUSP00000145363
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203661
AA Change: I381V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145345
Gene: ENSMUSG00000043088
AA Change: I381V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
Pfam:SEFIR 403 539 1.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203897
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect possibly damaging
Transcript: ENSMUST00000204774
AA Change: I381V

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145384
Gene: ENSMUSG00000043088
AA Change: I381V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:SEFIR 428 565 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205211
Meta Mutation Damage Score 0.2953 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as the receptor for interleukin-17C. The encoded protein signals to downstream components of the mitogen activated protein kinase (MAPK) pathway. Activity of this protein is important in the immune response to bacterial pathogens. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice exhibit increased susceptibility to DSS-induced colitis, imiquimod-induced psoriasis, and C. rodentium bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Il17re
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Il17re APN 6 113469599 missense probably damaging 0.99
IGL01568:Il17re APN 6 113470052 missense probably damaging 1.00
IGL01656:Il17re APN 6 113462973 splice site probably benign
IGL01994:Il17re APN 6 113468450 missense probably benign 0.13
IGL02261:Il17re APN 6 113468511 unclassified probably benign
IGL02699:Il17re APN 6 113468919 missense probably damaging 1.00
PIT4382001:Il17re UTSW 6 113469077 missense probably benign 0.00
R0195:Il17re UTSW 6 113466137 missense probably damaging 1.00
R1901:Il17re UTSW 6 113469704 missense probably damaging 0.98
R2232:Il17re UTSW 6 113464800 missense probably damaging 1.00
R2393:Il17re UTSW 6 113462353 missense possibly damaging 0.91
R2916:Il17re UTSW 6 113466028 critical splice donor site probably null
R4820:Il17re UTSW 6 113465855 missense probably benign 0.08
R4951:Il17re UTSW 6 113468907 missense probably damaging 1.00
R4974:Il17re UTSW 6 113469569 missense probably benign 0.14
R5070:Il17re UTSW 6 113459010 missense probably damaging 0.97
R5166:Il17re UTSW 6 113462962 missense probably benign 0.00
R5404:Il17re UTSW 6 113469102 missense probably benign 0.00
R5810:Il17re UTSW 6 113469596 missense probably damaging 1.00
R5916:Il17re UTSW 6 113470123 missense probably damaging 1.00
R6048:Il17re UTSW 6 113470108 missense possibly damaging 0.95
R7432:Il17re UTSW 6 113462371 missense probably benign 0.07
R7548:Il17re UTSW 6 113466387 missense probably damaging 1.00
R7658:Il17re UTSW 6 113458982 missense probably benign 0.23
R7716:Il17re UTSW 6 113462969 critical splice donor site probably null
R7942:Il17re UTSW 6 113466150 missense probably damaging 0.99
R8051:Il17re UTSW 6 113459367 missense probably benign 0.01
R8090:Il17re UTSW 6 113462289 nonsense probably null
R8302:Il17re UTSW 6 113466319 nonsense probably null
Z1177:Il17re UTSW 6 113464792 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATCCTCATGGTGGCACTCTG -3'
(R):5'- GGGAAGGCAAACTATAAGTGTTTTG -3'

Sequencing Primer
(F):5'- CTGTGTGTGTTAACTCAGCCAAAGC -3'
(R):5'- CTAGTGATGGCTAATTCCAG -3'
Posted On2014-11-11