Incidental Mutation 'R2357:Klrd1'
ID247432
Institutional Source Beutler Lab
Gene Symbol Klrd1
Ensembl Gene ENSMUSG00000030165
Gene Namekiller cell lectin-like receptor, subfamily D, member 1
SynonymsCD94
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2357 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129591782-129598775 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 129596909 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 71 (*71K)
Ref Sequence ENSEMBL: ENSMUSP00000123703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032268] [ENSMUST00000112063] [ENSMUST00000119520] [ENSMUST00000159804]
Predicted Effect probably null
Transcript: ENSMUST00000032268
AA Change: Y98*
SMART Domains Protein: ENSMUSP00000032268
Gene: ENSMUSG00000030165
AA Change: Y98*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CLECT 38 151 8.6e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112063
AA Change: Y121*
SMART Domains Protein: ENSMUSP00000107694
Gene: ENSMUSG00000030165
AA Change: Y121*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
CLECT 61 175 2.84e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119520
AA Change: Y140*
SMART Domains Protein: ENSMUSP00000113399
Gene: ENSMUSG00000030165
AA Change: Y140*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
CLECT 61 194 1.41e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159077
Predicted Effect probably null
Transcript: ENSMUST00000159804
AA Change: *71K
SMART Domains Protein: ENSMUSP00000123703
Gene: ENSMUSG00000030165
AA Change: *71K

DomainStartEndE-ValueType
Blast:CLECT 5 54 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203965
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are a distinct lineage of lymphocytes that mediate cytotoxic activity and secrete cytokines upon immune stimulation. Several genes of the C-type lectin superfamily, including members of the NKG2 family, are expressed by NK cells and may be involved in the regulation of NK cell function. KLRD1 (CD94) is an antigen preferentially expressed on NK cells and is classified as a type II membrane protein because it has an external C terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal NK cell function and susceptibillity to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Klrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4305001:Klrd1 UTSW 6 129596707 missense unknown
R0056:Klrd1 UTSW 6 129593775 missense probably benign 0.06
R2284:Klrd1 UTSW 6 129598381 missense probably benign 0.09
R5381:Klrd1 UTSW 6 129595434 missense possibly damaging 0.46
R5421:Klrd1 UTSW 6 129598443 missense probably damaging 1.00
R6090:Klrd1 UTSW 6 129595536 missense probably damaging 1.00
R6897:Klrd1 UTSW 6 129593505 missense possibly damaging 0.94
R7563:Klrd1 UTSW 6 129593738 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTTCCACGAGTGAATGACCTAGTC -3'
(R):5'- CATGCTCCACACAAGGTATTTG -3'

Sequencing Primer
(F):5'- GACCTAGTCACTGAAAAGTTTAAGG -3'
(R):5'- CACAAGGTATTTGGGTTTCTGAGCC -3'
Posted On2014-11-11