Incidental Mutation 'R0288:Top2a'
ID24744
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission 038507-MU
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R0288 (G1)
Quality Score209
Status Validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 99016423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect probably benign
Transcript: ENSMUST00000068031
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139730
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dennd1c A T 17: 57,076,870 probably null Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0335:Top2a UTSW 11 99022955 missense probably benign 0.08
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R7924:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7977:Top2a UTSW 11 99009605 missense probably damaging 1.00
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGCTCTTCTGACCATCAGTGCAAC -3'
(R):5'- ACCCCAGCTAACTGCCTGTGTAAC -3'

Sequencing Primer
(F):5'- TCCACGTCTATGGCAGTAAAG -3'
(R):5'- ACTGCCTGTGTAACCTGTAAGAG -3'
Protein Function and Prediction

DNA Topoisomerase II alpha (Top2a) encodes a DNA topoisomerase that, through an association with the pol II holoenzyme, controls the topologic states of DNA in both prokaryotes and eukaryotes and is required for chromatin-dependent coactivation (1). In eukaryote cells, Top2a catalyzes the relaxation of supercoiled DNA, catenation, decatenation, knotting, and unknotting of circular DNA. In mouse, Top2a is abundant in testis and spleen (2). Top2a expression varies throughout the cell cycle, with highest expression in G2/M; the level of Top2a mRNA is determined by a cell cycle-regulated promoter (3). Treatment of mouse zygotes with Top2a-targeted antisense oligodeoxynucleotides led to arrest at the 2-cell stage, indicating that Top2a is essential for preimplantation development (4).

References
Posted On2013-04-16
Science WriterAnne Murray