Incidental Mutation 'R2357:Ggt5'
ID247451
Institutional Source Beutler Lab
Gene Symbol Ggt5
Ensembl Gene ENSMUSG00000006344
Gene Namegamma-glutamyltransferase 5
SynonymsGGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2357 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75589340-75617200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 75609241 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 361 (I361L)
Ref Sequence ENSEMBL: ENSMUSP00000072074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072217] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably benign
Transcript: ENSMUST00000072217
AA Change: I361L

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: I361L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188444
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219247
Meta Mutation Damage Score 0.4117 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Ggt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Ggt5 APN 10 75610110 splice site probably benign
IGL01926:Ggt5 APN 10 75604101 missense probably benign 0.00
IGL02095:Ggt5 APN 10 75608803 missense probably benign 0.01
IGL02252:Ggt5 APN 10 75602732 missense possibly damaging 0.51
IGL02393:Ggt5 APN 10 75610237 splice site probably benign
IGL02515:Ggt5 APN 10 75589770 missense probably benign 0.23
IGL02528:Ggt5 APN 10 75610420 splice site probably benign
IGL02964:Ggt5 APN 10 75604128 missense probably benign 0.08
R0646:Ggt5 UTSW 10 75602648 missense probably damaging 0.99
R0834:Ggt5 UTSW 10 75604770 missense possibly damaging 0.73
R1454:Ggt5 UTSW 10 75609908 missense probably benign 0.01
R1650:Ggt5 UTSW 10 75604761 missense probably benign 0.00
R1846:Ggt5 UTSW 10 75610542 splice site probably null
R1896:Ggt5 UTSW 10 75604726 missense probably damaging 1.00
R2044:Ggt5 UTSW 10 75604087 missense probably damaging 0.97
R3151:Ggt5 UTSW 10 75609242 missense probably benign 0.35
R4667:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R4669:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R5060:Ggt5 UTSW 10 75604774 missense probably benign
R5756:Ggt5 UTSW 10 75604773 missense probably benign
R6156:Ggt5 UTSW 10 75609326 missense probably damaging 1.00
R6162:Ggt5 UTSW 10 75589792 missense possibly damaging 0.92
R6900:Ggt5 UTSW 10 75610537 missense possibly damaging 0.81
R8258:Ggt5 UTSW 10 75614832 missense probably benign 0.04
R8259:Ggt5 UTSW 10 75614832 missense probably benign 0.04
Z1088:Ggt5 UTSW 10 75608759 missense possibly damaging 0.81
Z1176:Ggt5 UTSW 10 75602618 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCACACAGGCTAAAGGAAGG -3'
(R):5'- TCTGCAGTGTCAGGAGCAAAG -3'

Sequencing Primer
(F):5'- TCTAGGGTAGACTGGAGGAA -3'
(R):5'- GCAAAGGAGACAGCCTGCC -3'
Posted On2014-11-11