Incidental Mutation 'R2357:Rabl3'
ID247470
Institutional Source Beutler Lab
Gene Symbol Rabl3
Ensembl Gene ENSMUSG00000022827
Gene NameRAB, member RAS oncogene family-like 3
Synonyms4930553C05Rik
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2357 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37539885-37572385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37541931 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000023524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023524] [ENSMUST00000023525] [ENSMUST00000130028]
Predicted Effect probably null
Transcript: ENSMUST00000023524
AA Change: D44G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023524
Gene: ENSMUSG00000022827
AA Change: D44G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 8 128 8.5e-8 PFAM
Pfam:Roc 8 132 1.2e-16 PFAM
Pfam:Ras 8 178 7.9e-15 PFAM
Pfam:Gtr1_RagA 8 181 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023525
SMART Domains Protein: ENSMUSP00000023525
Gene: ENSMUSG00000022828

DomainStartEndE-ValueType
TFIIE 28 175 2.69e-74 SMART
low complexity region 221 233 N/A INTRINSIC
low complexity region 332 351 N/A INTRINSIC
Pfam:TFIIE-A_C 354 440 9.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128036
Predicted Effect probably damaging
Transcript: ENSMUST00000130028
AA Change: D44G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122441
Gene: ENSMUSG00000022827
AA Change: D44G

DomainStartEndE-ValueType
Pfam:Arf 1 126 3.3e-6 PFAM
Pfam:Gtr1_RagA 8 118 5.5e-8 PFAM
Pfam:MMR_HSR1 8 127 9.8e-8 PFAM
Pfam:Ras 8 128 9.5e-15 PFAM
Pfam:Miro 8 129 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130350
Meta Mutation Damage Score 0.8034 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Usp9y G A Y: 1,394,050 T560I possibly damaging Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Rabl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02679:Rabl3 APN 16 37541925 missense probably damaging 1.00
xiamen UTSW 16 37541931 missense probably null 1.00
R1397:Rabl3 UTSW 16 37539974 splice site probably benign
R1990:Rabl3 UTSW 16 37563717 missense probably benign
R2125:Rabl3 UTSW 16 37556813 splice site probably null
R4945:Rabl3 UTSW 16 37541858 missense probably damaging 1.00
R7648:Rabl3 UTSW 16 37563758 missense probably damaging 0.98
R8174:Rabl3 UTSW 16 37556863 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATCCTGTCACGGGAGGTATTC -3'
(R):5'- AGTCTTAGAGTTACAGCTTTAGGC -3'

Sequencing Primer
(F):5'- GTCACGGGAGGTATTCAAACAATTTG -3'
(R):5'- AGACAACTGGGCTCACGTGTTAC -3'
Posted On2014-11-11