Mutagenetix > Incidental Mutation

Incidental Mutation 'R2357:Vmn2r111'

247472

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

040339-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R2357 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 22559170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

probably benign
Transcript: ENSMUST00000092491

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.3%

Validation Efficiency

97% (66/68)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	C	A	2: 68,739,500	T520K	possibly damaging	Het
9130204L05Rik	A	T	3: 91,088,426	S56R	probably benign	Het
Abca13	T	C	11: 9,297,336	L2361P	probably damaging	Het
Acsl6	T	A	11: 54,327,280	M248K	probably damaging	Het
Adam11	G	T	11: 102,774,508	V467L	probably benign	Het
Afap1	C	T	5: 35,984,274	H501Y	probably damaging	Het
Ankrd28	A	T	14: 31,764,294	Y22*	probably null	Het
Ccdc124	A	T	8: 70,868,535	L187Q	probably damaging	Het
Cdc42bpa	G	A	1: 180,067,227	S324N	possibly damaging	Het
Cgnl1	T	A	9: 71,725,668	K134*	probably null	Het
Cnpy3	G	T	17: 46,751,983	S47R	probably damaging	Het
Cpne8	A	T	15: 90,619,674	L96Q	probably damaging	Het
Crisp3	A	T	17: 40,222,505	Y212N	probably damaging	Het
Cryba1	A	T	11: 77,722,601		probably benign	Het
Cyc1	A	G	15: 76,345,566	M288V	possibly damaging	Het
Dnah8	T	A	17: 30,771,872	D3296E	probably benign	Het
Dnah8	A	G	17: 30,874,935	T4668A	probably benign	Het
Dnajb6	T	A	5: 29,753,640	F113I	probably damaging	Het
Dync2h1	A	G	9: 7,081,053	I2881T	probably benign	Het
Eps8l1	T	C	7: 4,470,355	S179P	probably benign	Het
Esco2	C	A	14: 65,826,551	A395S	probably benign	Het
Evi5l	T	C	8: 4,193,113		probably benign	Het
Exoc6b	T	C	6: 84,989,339	T218A	possibly damaging	Het
Gde1	A	T	7: 118,691,591	F170L	probably benign	Het
Ggt5	A	C	10: 75,609,241	I361L	probably benign	Het
Golga3	C	T	5: 110,202,648	T683M	probably damaging	Het
Golgb1	A	G	16: 36,912,008	Q539R	probably damaging	Het
Grm2	A	G	9: 106,647,581	V645A	probably damaging	Het
Gtf2h4	A	T	17: 35,667,999	V408D	probably damaging	Het
Gucy1a2	A	T	9: 3,797,299	H583L	probably damaging	Het
Hivep2	C	T	10: 14,143,299	A1938V	probably benign	Het
Iars	T	C	13: 49,688,203	Y56H	probably damaging	Het
Il17re	A	G	6: 113,468,470	I381V	possibly damaging	Het
Klrd1	T	A	6: 129,596,909	*71K	probably null	Het
Kng1	A	T	16: 23,079,065	Y405F	possibly damaging	Het
Kptn	G	T	7: 16,125,784	C311F	probably damaging	Het
Lama5	T	C	2: 180,180,097	I2982V	probably benign	Het
Mamstr	G	T	7: 45,642,330	D35Y	probably damaging	Het
Mdc1	A	G	17: 35,847,445	D239G	probably benign	Het
Mindy3	T	G	2: 12,404,176		probably benign	Het
Mrpl39	A	T	16: 84,727,564	H204Q	probably benign	Het
Myo16	G	A	8: 10,594,905	D1746N	possibly damaging	Het
Myo5a	T	A	9: 75,201,365	M1476K	probably damaging	Het
Nol4	A	G	18: 23,039,910	S45P	probably benign	Het
Nol8	T	C	13: 49,654,504		probably null	Het
Olfr1314	A	G	2: 112,092,398	I101T	possibly damaging	Het
Olfr73	A	T	2: 88,034,684	W152R	probably damaging	Het
Olfr777	C	A	10: 129,268,773	K183N	probably benign	Het
Olfr923	T	C	9: 38,828,338	S216P	probably benign	Het
Plau	T	A	14: 20,838,615	V100D	probably damaging	Het
Plpp7	T	C	2: 32,109,642	V6A	probably benign	Het
Prr14	T	C	7: 127,475,363	S356P	probably benign	Het
Rabl3	A	G	16: 37,541,931	D44G	probably null	Het
Rasa4	T	C	5: 136,091,247	V59A	probably damaging	Het
Rbm46	A	T	3: 82,864,458	D283E	probably benign	Het
Rictor	A	T	15: 6,783,562	N932I	probably damaging	Het
Rpl9-ps6	A	G	19: 32,466,343	V70A	probably benign	Het
St3gal1	A	G	15: 67,113,782	Y8H	probably benign	Het
Strn	G	A	17: 78,655,599	T745I	probably damaging	Het
Tbx15	C	T	3: 99,316,356		probably null	Het
Tbx20	T	A	9: 24,769,776	D140V	possibly damaging	Het
Ttn	A	C	2: 76,836,579	Y42*	probably null	Het
Usp9y	G	A	Y: 1,394,050	T560I	possibly damaging	Het
Vps13d	GG	GGGGGG	4: 145,074,977		probably null	Het
Wfdc12	A	T	2: 164,190,250	I40N	probably damaging	Het
Zfp78	G	A	7: 6,379,057	G369R	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7017:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGGAGCAAGACGATATTCC -3'
(R):5'- TACAGGATGCTATCAGGTTTTCTTC -3'

Sequencing Primer
(F):5'- GGAGCAAGACGATATTCCTTTTG -3'
(R):5'- TTCAAGGAGTTGGGAAACAATTC -3'

Posted On

2014-11-11