Incidental Mutation 'R2357:Usp9y'
ID247483
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Nameubiquitin specific peptidase 9, Y chromosome
SynonymsDffry, Fafl2
MMRRC Submission 040339-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2357 (G1)
Quality Score222
Status Validated
ChromosomeY
Chromosomal Location1298961-1459782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 1394050 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 560 (T560I)
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091188
AA Change: T560I

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044
AA Change: T560I

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik C A 2: 68,739,500 T520K possibly damaging Het
9130204L05Rik A T 3: 91,088,426 S56R probably benign Het
Abca13 T C 11: 9,297,336 L2361P probably damaging Het
Acsl6 T A 11: 54,327,280 M248K probably damaging Het
Adam11 G T 11: 102,774,508 V467L probably benign Het
Afap1 C T 5: 35,984,274 H501Y probably damaging Het
Ankrd28 A T 14: 31,764,294 Y22* probably null Het
Ccdc124 A T 8: 70,868,535 L187Q probably damaging Het
Cdc42bpa G A 1: 180,067,227 S324N possibly damaging Het
Cgnl1 T A 9: 71,725,668 K134* probably null Het
Cnpy3 G T 17: 46,751,983 S47R probably damaging Het
Cpne8 A T 15: 90,619,674 L96Q probably damaging Het
Crisp3 A T 17: 40,222,505 Y212N probably damaging Het
Cryba1 A T 11: 77,722,601 probably benign Het
Cyc1 A G 15: 76,345,566 M288V possibly damaging Het
Dnah8 T A 17: 30,771,872 D3296E probably benign Het
Dnah8 A G 17: 30,874,935 T4668A probably benign Het
Dnajb6 T A 5: 29,753,640 F113I probably damaging Het
Dync2h1 A G 9: 7,081,053 I2881T probably benign Het
Eps8l1 T C 7: 4,470,355 S179P probably benign Het
Esco2 C A 14: 65,826,551 A395S probably benign Het
Evi5l T C 8: 4,193,113 probably benign Het
Exoc6b T C 6: 84,989,339 T218A possibly damaging Het
Gde1 A T 7: 118,691,591 F170L probably benign Het
Ggt5 A C 10: 75,609,241 I361L probably benign Het
Golga3 C T 5: 110,202,648 T683M probably damaging Het
Golgb1 A G 16: 36,912,008 Q539R probably damaging Het
Grm2 A G 9: 106,647,581 V645A probably damaging Het
Gtf2h4 A T 17: 35,667,999 V408D probably damaging Het
Gucy1a2 A T 9: 3,797,299 H583L probably damaging Het
Hivep2 C T 10: 14,143,299 A1938V probably benign Het
Iars T C 13: 49,688,203 Y56H probably damaging Het
Il17re A G 6: 113,468,470 I381V possibly damaging Het
Klrd1 T A 6: 129,596,909 *71K probably null Het
Kng1 A T 16: 23,079,065 Y405F possibly damaging Het
Kptn G T 7: 16,125,784 C311F probably damaging Het
Lama5 T C 2: 180,180,097 I2982V probably benign Het
Mamstr G T 7: 45,642,330 D35Y probably damaging Het
Mdc1 A G 17: 35,847,445 D239G probably benign Het
Mindy3 T G 2: 12,404,176 probably benign Het
Mrpl39 A T 16: 84,727,564 H204Q probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myo5a T A 9: 75,201,365 M1476K probably damaging Het
Nol4 A G 18: 23,039,910 S45P probably benign Het
Nol8 T C 13: 49,654,504 probably null Het
Olfr1314 A G 2: 112,092,398 I101T possibly damaging Het
Olfr73 A T 2: 88,034,684 W152R probably damaging Het
Olfr777 C A 10: 129,268,773 K183N probably benign Het
Olfr923 T C 9: 38,828,338 S216P probably benign Het
Plau T A 14: 20,838,615 V100D probably damaging Het
Plpp7 T C 2: 32,109,642 V6A probably benign Het
Prr14 T C 7: 127,475,363 S356P probably benign Het
Rabl3 A G 16: 37,541,931 D44G probably null Het
Rasa4 T C 5: 136,091,247 V59A probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Rictor A T 15: 6,783,562 N932I probably damaging Het
Rpl9-ps6 A G 19: 32,466,343 V70A probably benign Het
St3gal1 A G 15: 67,113,782 Y8H probably benign Het
Strn G A 17: 78,655,599 T745I probably damaging Het
Tbx15 C T 3: 99,316,356 probably null Het
Tbx20 T A 9: 24,769,776 D140V possibly damaging Het
Ttn A C 2: 76,836,579 Y42* probably null Het
Vmn2r111 A G 17: 22,559,170 probably benign Het
Vps13d GG GGGGGG 4: 145,074,977 probably null Het
Wfdc12 A T 2: 164,190,250 I40N probably damaging Het
Zfp78 G A 7: 6,379,057 G369R probably damaging Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1432197 missense probably damaging 0.96
R0288:Usp9y UTSW Y 1333606 splice site probably benign
R0365:Usp9y UTSW Y 1364732 missense probably damaging 1.00
R0386:Usp9y UTSW Y 1316933 missense probably damaging 1.00
R0395:Usp9y UTSW Y 1340053 missense probably damaging 1.00
R0518:Usp9y UTSW Y 1307880 missense probably benign
R0521:Usp9y UTSW Y 1307880 missense probably benign
R0530:Usp9y UTSW Y 1333600 splice site probably benign
R0759:Usp9y UTSW Y 1299097 missense probably damaging 0.99
R0849:Usp9y UTSW Y 1394002 missense probably damaging 1.00
R0932:Usp9y UTSW Y 1315930 missense probably benign 0.37
R1018:Usp9y UTSW Y 1341414 splice site probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1730:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1743:Usp9y UTSW Y 1316727 missense probably damaging 1.00
R1765:Usp9y UTSW Y 1384454 missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1368089 missense probably damaging 1.00
R1783:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1889:Usp9y UTSW Y 1448829 intron probably null
R1901:Usp9y UTSW Y 1303371 critical splice donor site probably null
R2081:Usp9y UTSW Y 1381277 missense possibly damaging 0.65
R2119:Usp9y UTSW Y 1303451 missense probably benign 0.00
R2873:Usp9y UTSW Y 1310502 splice site probably benign
R3938:Usp9y UTSW Y 1313741 missense probably damaging 0.97
R4323:Usp9y UTSW Y 1434407 missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1304756 missense probably damaging 1.00
R4407:Usp9y UTSW Y 1336375 missense probably benign 0.16
R4457:Usp9y UTSW Y 1394078 missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1391284 missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1444559 missense probably damaging 0.99
R4834:Usp9y UTSW Y 1317002 missense probably benign 0.32
R4872:Usp9y UTSW Y 1307920 missense probably damaging 1.00
R4911:Usp9y UTSW Y 1308041 missense probably damaging 0.96
R4915:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R4962:Usp9y UTSW Y 1384336 missense probably damaging 1.00
R5378:Usp9y UTSW Y 1315928 missense probably damaging 0.99
R5422:Usp9y UTSW Y 1314676 missense probably benign
R5432:Usp9y UTSW Y 1368022 splice site probably null
R5442:Usp9y UTSW Y 1336467 missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1364714 missense probably benign 0.01
R5500:Usp9y UTSW Y 1341875 missense probably damaging 1.00
R5729:Usp9y UTSW Y 1381339 missense probably damaging 0.97
R5891:Usp9y UTSW Y 1341535 missense probably benign 0.05
R5920:Usp9y UTSW Y 1316730 missense probably damaging 1.00
R5948:Usp9y UTSW Y 1324996 missense possibly damaging 0.79
R6062:Usp9y UTSW Y 1454199 missense probably benign 0.28
R6265:Usp9y UTSW Y 1446843 missense probably benign 0.00
R6274:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R6313:Usp9y UTSW Y 1385355 missense probably benign
R6330:Usp9y UTSW Y 1340123 missense probably benign 0.20
R6471:Usp9y UTSW Y 1384511 missense probably damaging 1.00
R6547:Usp9y UTSW Y 1444612 missense probably damaging 0.99
R6791:Usp9y UTSW Y 1325042 splice site probably null
R7194:Usp9y UTSW Y 1304672 missense probably damaging 1.00
R7357:Usp9y UTSW Y 1333656 missense possibly damaging 0.58
R7374:Usp9y UTSW Y 1381305 missense probably benign 0.00
R7404:Usp9y UTSW Y 1341780 missense probably benign 0.35
R7481:Usp9y UTSW Y 1432180 missense probably benign 0.08
R7584:Usp9y UTSW Y 1384451 missense probably damaging 1.00
R7697:Usp9y UTSW Y 1316990 missense possibly damaging 0.72
R7713:Usp9y UTSW Y 1304411 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCCCTTTCTCTAAACATTGTC -3'
(R):5'- TATGCATGTGCCCCTGCTTG -3'

Sequencing Primer
(F):5'- GGGTTTGCTAATAATTAGAGGC -3'
(R):5'- CTGCTTGGGAAACTCTATGCTACAG -3'
Posted On2014-11-11