Incidental Mutation 'R2370:Orc4'
ID 247486
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Name origin recognition complex, subunit 4
Synonyms mMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission 040350-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.969) question?
Stock # R2370 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 48902824-48950277 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48933099 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000088497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000123271] [ENSMUST00000142851] [ENSMUST00000149679]
AlphaFold O88708
Predicted Effect probably benign
Transcript: ENSMUST00000028098
AA Change: V120A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: V120A

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090976
AA Change: V120A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761
AA Change: V120A

DomainStartEndE-ValueType
Pfam:AAA_16 34 138 3.3e-14 PFAM
Pfam:KAP_NTPase 38 123 2.9e-7 PFAM
Pfam:Arch_ATPase 43 130 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect probably benign
Transcript: ENSMUST00000142851
AA Change: V120A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: V120A

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149679
SMART Domains Protein: ENSMUSP00000121114
Gene: ENSMUSG00000026761

DomainStartEndE-ValueType
SCOP:d1jbka_ 43 73 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abca13 A G 11: 9,256,185 T162A possibly damaging Het
Adamts9 T A 6: 92,860,203 D578V probably damaging Het
Atp6v1a T C 16: 44,107,040 T295A probably benign Het
Brinp1 A G 4: 68,762,947 S449P probably damaging Het
Ccdc40 A G 11: 119,263,117 T1072A probably benign Het
Chil4 C A 3: 106,214,300 E78* probably null Het
Cul7 A G 17: 46,661,641 Y1250C probably damaging Het
Dock3 T C 9: 106,952,355 D1120G probably damaging Het
Gfod1 A G 13: 43,201,145 M118T probably benign Het
Ints5 A G 19: 8,896,779 T701A probably benign Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Mast4 T A 13: 102,774,187 E457D probably damaging Het
Mettl4 T C 17: 94,733,148 D404G probably damaging Het
Mgat4a A G 1: 37,464,533 F58L probably damaging Het
Myh4 A G 11: 67,255,628 K1476E probably damaging Het
Myl7 T C 11: 5,896,684 E175G probably damaging Het
Myo18a A G 11: 77,777,770 E152G probably benign Het
Ncan G A 8: 70,112,813 T187I probably benign Het
Nfatc3 A G 8: 106,108,455 Y803C probably damaging Het
Nlrp4f T C 13: 65,190,846 Y659C probably damaging Het
Noxred1 T C 12: 87,227,046 T74A probably benign Het
Ntrk2 A T 13: 59,054,434 M619L probably benign Het
Olfr1143 A T 2: 87,802,815 N142I probably benign Het
Polq T A 16: 37,073,939 Y2037N probably damaging Het
Rimbp2 A G 5: 128,803,844 C160R probably damaging Het
Rps6ka4 T C 19: 6,830,100 S721G possibly damaging Het
Skap2 C T 6: 51,921,330 R140Q probably damaging Het
Srprb C T 9: 103,197,556 R838H probably damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
R7572:Orc4 UTSW 2 48910236 missense probably benign 0.01
R7938:Orc4 UTSW 2 48910191 missense possibly damaging 0.79
R9267:Orc4 UTSW 2 48937522 nonsense probably null
R9463:Orc4 UTSW 2 48936771 critical splice donor site probably null
R9472:Orc4 UTSW 2 48905551 missense probably benign 0.03
R9480:Orc4 UTSW 2 48905551 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTCACGCTACTTCATAAGTCTTG -3'
(R):5'- TCCAAGGAATGCTTCGATTACC -3'

Sequencing Primer
(F):5'- GCTTGATGACTAAATATGCCA -3'
(R):5'- CTGTGTCAAATACTTGCTTCTT -3'
Posted On 2014-11-11