Mutagenetix > Incidental Mutation

Incidental Mutation 'R2370:Chil4'

247488

Institutional Source

Beutler Lab

Gene Symbol

Chil4

Ensembl Gene

ENSMUSG00000063779

Gene Name

chitinase-like 4

Synonyms

Ym2, Chi3l4

MMRRC Submission

040350-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2370 (G1)

Quality Score

203

Status

Not validated

Chromosome

Chromosomal Location

106201490-106219507 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 106214300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 78 (E78*)

Ref Sequence

ENSEMBL: ENSMUSP00000080851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082219]

AlphaFold

Q91Z98

Predicted Effect

probably null
Transcript: ENSMUST00000082219
AA Change: E78*

SMART Domains

Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: E78*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Glyco_18	22	365	1.77e-132	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196128

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Abca13	A	G	11: 9,256,185	T162A	possibly damaging	Het
Adamts9	T	A	6: 92,860,203	D578V	probably damaging	Het
Atp6v1a	T	C	16: 44,107,040	T295A	probably benign	Het
Brinp1	A	G	4: 68,762,947	S449P	probably damaging	Het
Ccdc40	A	G	11: 119,263,117	T1072A	probably benign	Het
Cul7	A	G	17: 46,661,641	Y1250C	probably damaging	Het
Dock3	T	C	9: 106,952,355	D1120G	probably damaging	Het
Gfod1	A	G	13: 43,201,145	M118T	probably benign	Het
Ints5	A	G	19: 8,896,779	T701A	probably benign	Het
Map4k2	G	T	19: 6,341,928	E91*	probably null	Het
Mast4	T	A	13: 102,774,187	E457D	probably damaging	Het
Mettl4	T	C	17: 94,733,148	D404G	probably damaging	Het
Mgat4a	A	G	1: 37,464,533	F58L	probably damaging	Het
Myh4	A	G	11: 67,255,628	K1476E	probably damaging	Het
Myl7	T	C	11: 5,896,684	E175G	probably damaging	Het
Myo18a	A	G	11: 77,777,770	E152G	probably benign	Het
Ncan	G	A	8: 70,112,813	T187I	probably benign	Het
Nfatc3	A	G	8: 106,108,455	Y803C	probably damaging	Het
Nlrp4f	T	C	13: 65,190,846	Y659C	probably damaging	Het
Noxred1	T	C	12: 87,227,046	T74A	probably benign	Het
Ntrk2	A	T	13: 59,054,434	M619L	probably benign	Het
Olfr1143	A	T	2: 87,802,815	N142I	probably benign	Het
Orc4	A	G	2: 48,933,099	V120A	probably benign	Het
Polq	T	A	16: 37,073,939	Y2037N	probably damaging	Het
Rimbp2	A	G	5: 128,803,844	C160R	probably damaging	Het
Rps6ka4	T	C	19: 6,830,100	S721G	possibly damaging	Het
Skap2	C	T	6: 51,921,330	R140Q	probably damaging	Het
Srprb	C	T	9: 103,197,556	R838H	probably damaging	Het

Other mutations in Chil4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Chil4	APN	3	106201797	missense	probably benign
IGL02457:Chil4	APN	3	106214399	missense	probably benign
R1087:Chil4	UTSW	3	106210565	missense	probably benign	0.01
R1398:Chil4	UTSW	3	106219509	splice site	probably null
R1503:Chil4	UTSW	3	106206034	missense	probably benign
R1553:Chil4	UTSW	3	106203690	missense	probably benign	0.02
R1806:Chil4	UTSW	3	106210643	splice site	probably benign
R1873:Chil4	UTSW	3	106206098	missense	probably benign	0.00
R2069:Chil4	UTSW	3	106219455	missense	probably benign	0.16
R2100:Chil4	UTSW	3	106214347	missense	probably benign
R2984:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R2985:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R3522:Chil4	UTSW	3	106203740	missense	probably benign	0.08
R3919:Chil4	UTSW	3	106202532	missense	probably benign	0.00
R4033:Chil4	UTSW	3	106214449	missense	probably damaging	1.00
R4181:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4184:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4301:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4347:Chil4	UTSW	3	106202828	missense	probably benign
R4391:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4395:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4418:Chil4	UTSW	3	106203727	missense	possibly damaging	0.95
R4483:Chil4	UTSW	3	106214362	missense	probably damaging	1.00
R4544:Chil4	UTSW	3	106210606	missense	probably damaging	0.97
R4887:Chil4	UTSW	3	106204144	missense	probably benign	0.01
R4949:Chil4	UTSW	3	106206092	missense	possibly damaging	0.83
R5076:Chil4	UTSW	3	106202597	missense	probably damaging	1.00
R5146:Chil4	UTSW	3	106202834	missense	probably benign	0.18
R5254:Chil4	UTSW	3	106219452	missense	probably benign	0.00
R5521:Chil4	UTSW	3	106203697	missense	possibly damaging	0.50
R5790:Chil4	UTSW	3	106202578	missense	probably benign	0.00
R5883:Chil4	UTSW	3	106210570	missense	possibly damaging	0.48
R6010:Chil4	UTSW	3	106214395	missense	probably damaging	1.00
R6257:Chil4	UTSW	3	106204096	missense	possibly damaging	0.84
R6269:Chil4	UTSW	3	106204171	missense	probably damaging	1.00
R6602:Chil4	UTSW	3	106210590	missense	probably benign	0.00
R7113:Chil4	UTSW	3	106202767	missense	probably damaging	1.00
R7113:Chil4	UTSW	3	106214348	missense	probably benign
R7188:Chil4	UTSW	3	106204159	missense	probably damaging	1.00
R7980:Chil4	UTSW	3	106202744	missense	probably damaging	1.00
R8810:Chil4	UTSW	3	106201805	missense	probably damaging	0.99
R9300:Chil4	UTSW	3	106202558	missense	probably benign	0.10
R9307:Chil4	UTSW	3	106204066	critical splice donor site	probably null
R9529:Chil4	UTSW	3	106211340	missense	probably damaging	1.00
X0067:Chil4	UTSW	3	106206034	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CATGTGGTTATGAGACATTCAGAGG -3'
(R):5'- CCTACCAGCTGATGTGCTAC -3'

Sequencing Primer
(F):5'- TGTAAAATCAAGGACATGAGTGATAG -3'
(R):5'- TGCTACTATACCAGCTGGGCTAAG -3'

Posted On

2014-11-11