Mutagenetix > Incidental Mutation

Incidental Mutation 'R2370:Adamts9'

247492

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

040350-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2370 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92860203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 578 (D578V)

Ref Sequence

ENSEMBL: ENSMUSP00000126498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]

AlphaFold

E9PUN6

Predicted Effect

probably benign
Transcript: ENSMUST00000113438
AA Change: D1159V

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: D1159V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130314

Predicted Effect

probably damaging
Transcript: ENSMUST00000167391
AA Change: D578V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: D578V

Domain	Start	End	E-Value	Type
TSP1	10	62	2.15e-9	SMART
Pfam:ADAM_spacer1	172	290	6.1e-35	PFAM
TSP1	300	355	1.14e0	SMART
Blast:TSP1	357	412	3e-28	BLAST
TSP1	419	473	3.78e-5	SMART
TSP1	474	528	5.64e-4	SMART
TSP1	529	585	1.25e-5	SMART
TSP1	605	659	1.45e-6	SMART
TSP1	661	715	4.41e-6	SMART
TSP1	747	799	7.06e-5	SMART
TSP1	800	855	4.24e-8	SMART
TSP1	859	914	8.23e-6	SMART
TSP1	915	970	1.23e-4	SMART
TSP1	971	1028	2e-4	SMART
TSP1	1030	1091	1.25e-5	SMART
TSP1	1095	1149	3.47e-4	SMART
Pfam:GON	1150	1350	2.1e-86	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Abca13	A	G	11: 9,256,185	T162A	possibly damaging	Het
Atp6v1a	T	C	16: 44,107,040	T295A	probably benign	Het
Brinp1	A	G	4: 68,762,947	S449P	probably damaging	Het
Ccdc40	A	G	11: 119,263,117	T1072A	probably benign	Het
Chil4	C	A	3: 106,214,300	E78*	probably null	Het
Cul7	A	G	17: 46,661,641	Y1250C	probably damaging	Het
Dock3	T	C	9: 106,952,355	D1120G	probably damaging	Het
Gfod1	A	G	13: 43,201,145	M118T	probably benign	Het
Ints5	A	G	19: 8,896,779	T701A	probably benign	Het
Map4k2	G	T	19: 6,341,928	E91*	probably null	Het
Mast4	T	A	13: 102,774,187	E457D	probably damaging	Het
Mettl4	T	C	17: 94,733,148	D404G	probably damaging	Het
Mgat4a	A	G	1: 37,464,533	F58L	probably damaging	Het
Myh4	A	G	11: 67,255,628	K1476E	probably damaging	Het
Myl7	T	C	11: 5,896,684	E175G	probably damaging	Het
Myo18a	A	G	11: 77,777,770	E152G	probably benign	Het
Ncan	G	A	8: 70,112,813	T187I	probably benign	Het
Nfatc3	A	G	8: 106,108,455	Y803C	probably damaging	Het
Nlrp4f	T	C	13: 65,190,846	Y659C	probably damaging	Het
Noxred1	T	C	12: 87,227,046	T74A	probably benign	Het
Ntrk2	A	T	13: 59,054,434	M619L	probably benign	Het
Olfr1143	A	T	2: 87,802,815	N142I	probably benign	Het
Orc4	A	G	2: 48,933,099	V120A	probably benign	Het
Polq	T	A	16: 37,073,939	Y2037N	probably damaging	Het
Rimbp2	A	G	5: 128,803,844	C160R	probably damaging	Het
Rps6ka4	T	C	19: 6,830,100	S721G	possibly damaging	Het
Skap2	C	T	6: 51,921,330	R140Q	probably damaging	Het
Srprb	C	T	9: 103,197,556	R838H	probably damaging	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0620:Adamts9	UTSW	6	92858113	missense	possibly damaging	0.95
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R1986:Adamts9	UTSW	6	92796394	missense	probably benign
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5260:Adamts9	UTSW	6	92807137	missense	probably benign	0.00
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7028:Adamts9	UTSW	6	92909793	nonsense	probably null
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7791:Adamts9	UTSW	6	92872385	missense	probably benign	0.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R7974:Adamts9	UTSW	6	92909687	critical splice donor site	probably null
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGCCCCATTTCTATAGTCAAGTC -3'
(R):5'- CCCTGTGTTAAGGCATCCAG -3'

Sequencing Primer
(F):5'- TGGGTTCTCGGTATACTC -3'
(R):5'- CTTATCCCTCTTTGAAACGGAAGCAG -3'

Posted On

2014-11-11