Incidental Mutation 'R2370:Ncan'
ID 247495
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 040350-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2370 (G1)
Quality Score 199
Status Not validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70565463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 187 (T187I)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: T187I

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: T187I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Abca13 A G 11: 9,206,185 (GRCm39) T162A possibly damaging Het
Adamts9 T A 6: 92,837,184 (GRCm39) D578V probably damaging Het
Atp6v1a T C 16: 43,927,403 (GRCm39) T295A probably benign Het
Brinp1 A G 4: 68,681,184 (GRCm39) S449P probably damaging Het
Ccdc40 A G 11: 119,153,943 (GRCm39) T1072A probably benign Het
Chil4 C A 3: 106,121,616 (GRCm39) E78* probably null Het
Cul7 A G 17: 46,972,567 (GRCm39) Y1250C probably damaging Het
Dock3 T C 9: 106,829,554 (GRCm39) D1120G probably damaging Het
Gfod1 A G 13: 43,354,621 (GRCm39) M118T probably benign Het
Ints5 A G 19: 8,874,143 (GRCm39) T701A probably benign Het
Map4k2 G T 19: 6,391,958 (GRCm39) E91* probably null Het
Mast4 T A 13: 102,910,695 (GRCm39) E457D probably damaging Het
Mettl4 T C 17: 95,040,576 (GRCm39) D404G probably damaging Het
Mgat4a A G 1: 37,503,614 (GRCm39) F58L probably damaging Het
Myh4 A G 11: 67,146,454 (GRCm39) K1476E probably damaging Het
Myl7 T C 11: 5,846,684 (GRCm39) E175G probably damaging Het
Myo18a A G 11: 77,668,596 (GRCm39) E152G probably benign Het
Nfatc3 A G 8: 106,835,087 (GRCm39) Y803C probably damaging Het
Nlrp4f T C 13: 65,338,660 (GRCm39) Y659C probably damaging Het
Noxred1 T C 12: 87,273,820 (GRCm39) T74A probably benign Het
Ntrk2 A T 13: 59,202,248 (GRCm39) M619L probably benign Het
Or5w18 A T 2: 87,633,159 (GRCm39) N142I probably benign Het
Orc4 A G 2: 48,823,111 (GRCm39) V120A probably benign Het
Polq T A 16: 36,894,301 (GRCm39) Y2037N probably damaging Het
Rimbp2 A G 5: 128,880,908 (GRCm39) C160R probably damaging Het
Rps6ka4 T C 19: 6,807,468 (GRCm39) S721G possibly damaging Het
Skap2 C T 6: 51,898,310 (GRCm39) R140Q probably damaging Het
Srprb C T 9: 103,074,755 (GRCm39) R838H probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGGCAAAGCAGTAGACATC -3'
(R):5'- CTCTGTCTTTAGGAAATATGCTCCAAG -3'

Sequencing Primer
(F):5'- CAGTAGACATCGTAGAGTTCCTGC -3'
(R):5'- AAGAAGGTCCTTTCCCTAAGATTCC -3'
Posted On 2014-11-11