Mutagenetix > Incidental Mutation

Incidental Mutation 'R2370:Nfatc3'

247497

Institutional Source

Beutler Lab

Gene Symbol

Nfatc3

Ensembl Gene

ENSMUSG00000031902

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3

Synonyms

NFATx, NFAT4, D8Ertd281e

MMRRC Submission

040350-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2370 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106058840-106130537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106108455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 803 (Y803C)

Ref Sequence

ENSEMBL: ENSMUSP00000148551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109308
AA Change: Y811C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: Y811C

Domain	Start	End	E-Value	Type
low complexity region	153	182	N/A	INTRINSIC
low complexity region	205	225	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	286	305	N/A	INTRINSIC
Pfam:RHD_DNA_bind	434	593	4.9e-25	PFAM
IPT	600	699	1.19e-20	SMART
low complexity region	713	722	N/A	INTRINSIC
low complexity region	917	938	N/A	INTRINSIC
low complexity region	954	967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211991
AA Change: Y803C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212742
AA Change: Y803C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,580,386	A115T	probably benign	Het
Abca13	A	G	11: 9,256,185	T162A	possibly damaging	Het
Adamts9	T	A	6: 92,860,203	D578V	probably damaging	Het
Atp6v1a	T	C	16: 44,107,040	T295A	probably benign	Het
Brinp1	A	G	4: 68,762,947	S449P	probably damaging	Het
Ccdc40	A	G	11: 119,263,117	T1072A	probably benign	Het
Chil4	C	A	3: 106,214,300	E78*	probably null	Het
Cul7	A	G	17: 46,661,641	Y1250C	probably damaging	Het
Dock3	T	C	9: 106,952,355	D1120G	probably damaging	Het
Gfod1	A	G	13: 43,201,145	M118T	probably benign	Het
Ints5	A	G	19: 8,896,779	T701A	probably benign	Het
Map4k2	G	T	19: 6,341,928	E91*	probably null	Het
Mast4	T	A	13: 102,774,187	E457D	probably damaging	Het
Mettl4	T	C	17: 94,733,148	D404G	probably damaging	Het
Mgat4a	A	G	1: 37,464,533	F58L	probably damaging	Het
Myh4	A	G	11: 67,255,628	K1476E	probably damaging	Het
Myl7	T	C	11: 5,896,684	E175G	probably damaging	Het
Myo18a	A	G	11: 77,777,770	E152G	probably benign	Het
Ncan	G	A	8: 70,112,813	T187I	probably benign	Het
Nlrp4f	T	C	13: 65,190,846	Y659C	probably damaging	Het
Noxred1	T	C	12: 87,227,046	T74A	probably benign	Het
Ntrk2	A	T	13: 59,054,434	M619L	probably benign	Het
Olfr1143	A	T	2: 87,802,815	N142I	probably benign	Het
Orc4	A	G	2: 48,933,099	V120A	probably benign	Het
Polq	T	A	16: 37,073,939	Y2037N	probably damaging	Het
Rimbp2	A	G	5: 128,803,844	C160R	probably damaging	Het
Rps6ka4	T	C	19: 6,830,100	S721G	possibly damaging	Het
Skap2	C	T	6: 51,921,330	R140Q	probably damaging	Het
Srprb	C	T	9: 103,197,556	R838H	probably damaging	Het

Other mutations in Nfatc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Nfatc3	APN	8	106099177	missense	probably damaging	1.00
IGL01755:Nfatc3	APN	8	106127921	missense	probably benign	0.42
IGL02314:Nfatc3	APN	8	106078900	missense	probably benign	0.21
IGL02724:Nfatc3	APN	8	106108185	missense	probably benign	0.29
Kampf	UTSW	8	106099150	missense	probably benign	0.23
Struggles	UTSW	8	106083870	nonsense	probably null
PIT1430001:Nfatc3	UTSW	8	106059973	missense	possibly damaging	0.78
PIT4515001:Nfatc3	UTSW	8	106079203	missense	possibly damaging	0.94
R0088:Nfatc3	UTSW	8	106127942	missense	possibly damaging	0.90
R0348:Nfatc3	UTSW	8	106092195	missense	probably damaging	1.00
R0410:Nfatc3	UTSW	8	106096196	missense	probably damaging	1.00
R1509:Nfatc3	UTSW	8	106083854	missense	possibly damaging	0.46
R1702:Nfatc3	UTSW	8	106092160	missense	probably damaging	1.00
R1735:Nfatc3	UTSW	8	106083834	missense	probably damaging	1.00
R1736:Nfatc3	UTSW	8	106078850	missense	probably damaging	1.00
R1758:Nfatc3	UTSW	8	106099136	missense	probably damaging	1.00
R2878:Nfatc3	UTSW	8	106092144	missense	probably damaging	1.00
R3802:Nfatc3	UTSW	8	106079645	missense	probably damaging	0.99
R3959:Nfatc3	UTSW	8	106099077	nonsense	probably null
R4006:Nfatc3	UTSW	8	106108839	missense	probably benign	0.00
R4079:Nfatc3	UTSW	8	106079491	missense	probably damaging	0.98
R4589:Nfatc3	UTSW	8	106079073	missense	probably damaging	1.00
R4818:Nfatc3	UTSW	8	106108379	missense	probably benign	0.00
R4907:Nfatc3	UTSW	8	106079727	missense	probably damaging	1.00
R5042:Nfatc3	UTSW	8	106108125	missense	probably benign	0.25
R5632:Nfatc3	UTSW	8	106079057	missense	probably damaging	1.00
R5741:Nfatc3	UTSW	8	106079066	missense	probably damaging	1.00
R5885:Nfatc3	UTSW	8	106096312	missense	probably benign	0.00
R6439:Nfatc3	UTSW	8	106083870	nonsense	probably null
R6557:Nfatc3	UTSW	8	106119354	missense	probably benign	0.01
R6737:Nfatc3	UTSW	8	106083969	missense	probably damaging	1.00
R6925:Nfatc3	UTSW	8	106119322	missense	probably benign	0.00
R7260:Nfatc3	UTSW	8	106108946	missense	probably benign	0.00
R7429:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7430:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7526:Nfatc3	UTSW	8	106079083	missense	probably damaging	1.00
R7760:Nfatc3	UTSW	8	106108341	missense	possibly damaging	0.66
R8783:Nfatc3	UTSW	8	106099152	missense	possibly damaging	0.63
R8867:Nfatc3	UTSW	8	106079008	missense	probably damaging	1.00
R8978:Nfatc3	UTSW	8	106108770	missense	probably benign	0.03
R9021:Nfatc3	UTSW	8	106092113	missense	probably damaging	1.00
R9066:Nfatc3	UTSW	8	106099150	missense	probably benign	0.23
R9538:Nfatc3	UTSW	8	106108152	missense	probably benign	0.35
R9656:Nfatc3	UTSW	8	106104134	missense	probably damaging	1.00
X0063:Nfatc3	UTSW	8	106083939	missense	probably damaging	1.00
X0064:Nfatc3	UTSW	8	106108349	missense	probably benign	0.04
Z1177:Nfatc3	UTSW	8	106092066	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTGTCAAGTGCAGCCAG -3'
(R):5'- CATTGACTGCAGATGAGGTGG -3'

Sequencing Primer
(F):5'- GCAGCCAGCATATACATCTATGGTAG -3'
(R):5'- TTTGCACAGAATGAGGTGAATGTGC -3'

Posted On

2014-11-11