Incidental Mutation 'R2370:Myl7'
ID247500
Institutional Source Beutler Lab
Gene Symbol Myl7
Ensembl Gene ENSMUSG00000020469
Gene Namemyosin, light polypeptide 7, regulatory
SynonymsRLC-A, MLC-2alpha, MLC2a, Mylc2a
MMRRC Submission 040350-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2370 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5896637-5898782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5896684 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 175 (E175G)
Ref Sequence ENSEMBL: ENSMUSP00000099985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102920] [ENSMUST00000102921] [ENSMUST00000109822] [ENSMUST00000109823]
Predicted Effect probably benign
Transcript: ENSMUST00000102920
SMART Domains Protein: ENSMUSP00000099984
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
Pfam:Hexokinase_1 10 217 4.3e-80 PFAM
Pfam:Hexokinase_2 219 458 1.3e-100 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102921
AA Change: E175G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099985
Gene: ENSMUSG00000020469
AA Change: E175G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
EFh 36 64 1.02e-2 SMART
EFh 106 134 8.25e-3 SMART
Blast:EFh 142 170 9e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109822
SMART Domains Protein: ENSMUSP00000105447
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
Pfam:Hexokinase_1 10 217 1e-79 PFAM
Pfam:Hexokinase_2 219 458 7.8e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109823
SMART Domains Protein: ENSMUSP00000105448
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
Pfam:Hexokinase_1 15 216 1.9e-74 PFAM
Pfam:Hexokinase_2 221 455 2.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125434
SMART Domains Protein: ENSMUSP00000123016
Gene: ENSMUSG00000041798

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
Pfam:Hexokinase_2 45 87 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-in allele show lack of atrial myofibrillar organization, atrial malfunction, aberrant cardiac chamber and looping morphogenesis, defects in yolk sac and intraembryonic vasculature, growth arrest, pericardial edema, and death at E10.5-E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abca13 A G 11: 9,256,185 T162A possibly damaging Het
Adamts9 T A 6: 92,860,203 D578V probably damaging Het
Atp6v1a T C 16: 44,107,040 T295A probably benign Het
Brinp1 A G 4: 68,762,947 S449P probably damaging Het
Ccdc40 A G 11: 119,263,117 T1072A probably benign Het
Chil4 C A 3: 106,214,300 E78* probably null Het
Cul7 A G 17: 46,661,641 Y1250C probably damaging Het
Dock3 T C 9: 106,952,355 D1120G probably damaging Het
Gfod1 A G 13: 43,201,145 M118T probably benign Het
Ints5 A G 19: 8,896,779 T701A probably benign Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Mast4 T A 13: 102,774,187 E457D probably damaging Het
Mettl4 T C 17: 94,733,148 D404G probably damaging Het
Mgat4a A G 1: 37,464,533 F58L probably damaging Het
Myh4 A G 11: 67,255,628 K1476E probably damaging Het
Myo18a A G 11: 77,777,770 E152G probably benign Het
Ncan G A 8: 70,112,813 T187I probably benign Het
Nfatc3 A G 8: 106,108,455 Y803C probably damaging Het
Nlrp4f T C 13: 65,190,846 Y659C probably damaging Het
Noxred1 T C 12: 87,227,046 T74A probably benign Het
Ntrk2 A T 13: 59,054,434 M619L probably benign Het
Olfr1143 A T 2: 87,802,815 N142I probably benign Het
Orc4 A G 2: 48,933,099 V120A probably benign Het
Polq T A 16: 37,073,939 Y2037N probably damaging Het
Rimbp2 A G 5: 128,803,844 C160R probably damaging Het
Rps6ka4 T C 19: 6,830,100 S721G possibly damaging Het
Skap2 C T 6: 51,921,330 R140Q probably damaging Het
Srprb C T 9: 103,197,556 R838H probably damaging Het
Other mutations in Myl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Myl7 APN 11 5897137 missense possibly damaging 0.84
IGL03199:Myl7 APN 11 5898205 missense probably damaging 1.00
R3902:Myl7 UTSW 11 5898430 missense probably damaging 1.00
R3902:Myl7 UTSW 11 5898431 missense probably damaging 0.99
R4449:Myl7 UTSW 11 5897354 missense probably damaging 1.00
R4766:Myl7 UTSW 11 5898171 missense probably benign 0.00
R5293:Myl7 UTSW 11 5898521 unclassified probably benign
R7666:Myl7 UTSW 11 5897140 missense possibly damaging 0.76
R7862:Myl7 UTSW 11 5897157 missense probably benign 0.01
R7945:Myl7 UTSW 11 5897157 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTTGTGGCTCATTCCTGG -3'
(R):5'- GGTTGAAAAGGCTGAGTCCG -3'

Sequencing Primer
(F):5'- TCATTCCTGGGCCTCATGGAG -3'
(R):5'- TCCGGAAGCACAGCTGTTG -3'
Posted On2014-11-11