Incidental Mutation 'R2370:Ccdc40'
ID 247504
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Name coiled-coil domain containing 40
Synonyms B930008I02Rik
MMRRC Submission 040350-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.174) question?
Stock # R2370 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119119398-119156064 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119153943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1072 (T1072A)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000035935] [ENSMUST00000053440] [ENSMUST00000106258] [ENSMUST00000106259]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026666
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035935
AA Change: T1072A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: T1072A

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053440
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126652
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,557,349 (GRCm39) A115T probably benign Het
Abca13 A G 11: 9,206,185 (GRCm39) T162A possibly damaging Het
Adamts9 T A 6: 92,837,184 (GRCm39) D578V probably damaging Het
Atp6v1a T C 16: 43,927,403 (GRCm39) T295A probably benign Het
Brinp1 A G 4: 68,681,184 (GRCm39) S449P probably damaging Het
Chil4 C A 3: 106,121,616 (GRCm39) E78* probably null Het
Cul7 A G 17: 46,972,567 (GRCm39) Y1250C probably damaging Het
Dock3 T C 9: 106,829,554 (GRCm39) D1120G probably damaging Het
Gfod1 A G 13: 43,354,621 (GRCm39) M118T probably benign Het
Ints5 A G 19: 8,874,143 (GRCm39) T701A probably benign Het
Map4k2 G T 19: 6,391,958 (GRCm39) E91* probably null Het
Mast4 T A 13: 102,910,695 (GRCm39) E457D probably damaging Het
Mettl4 T C 17: 95,040,576 (GRCm39) D404G probably damaging Het
Mgat4a A G 1: 37,503,614 (GRCm39) F58L probably damaging Het
Myh4 A G 11: 67,146,454 (GRCm39) K1476E probably damaging Het
Myl7 T C 11: 5,846,684 (GRCm39) E175G probably damaging Het
Myo18a A G 11: 77,668,596 (GRCm39) E152G probably benign Het
Ncan G A 8: 70,565,463 (GRCm39) T187I probably benign Het
Nfatc3 A G 8: 106,835,087 (GRCm39) Y803C probably damaging Het
Nlrp4f T C 13: 65,338,660 (GRCm39) Y659C probably damaging Het
Noxred1 T C 12: 87,273,820 (GRCm39) T74A probably benign Het
Ntrk2 A T 13: 59,202,248 (GRCm39) M619L probably benign Het
Or5w18 A T 2: 87,633,159 (GRCm39) N142I probably benign Het
Orc4 A G 2: 48,823,111 (GRCm39) V120A probably benign Het
Polq T A 16: 36,894,301 (GRCm39) Y2037N probably damaging Het
Rimbp2 A G 5: 128,880,908 (GRCm39) C160R probably damaging Het
Rps6ka4 T C 19: 6,807,468 (GRCm39) S721G possibly damaging Het
Skap2 C T 6: 51,898,310 (GRCm39) R140Q probably damaging Het
Srprb C T 9: 103,074,755 (GRCm39) R838H probably damaging Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119,133,545 (GRCm39) missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119,133,911 (GRCm39) missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119,122,797 (GRCm39) splice site probably null
IGL02640:Ccdc40 APN 11 119,128,904 (GRCm39) missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119,133,336 (GRCm39) missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119,154,027 (GRCm39) missense possibly damaging 0.69
PIT4151001:Ccdc40 UTSW 11 119,133,277 (GRCm39) missense probably damaging 1.00
R0139:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119,155,125 (GRCm39) missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119,133,630 (GRCm39) missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119,122,629 (GRCm39) missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119,154,015 (GRCm39) missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119,121,522 (GRCm39) critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119,150,730 (GRCm39) missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119,153,901 (GRCm39) splice site probably null
R2106:Ccdc40 UTSW 11 119,155,123 (GRCm39) missense probably damaging 1.00
R3421:Ccdc40 UTSW 11 119,125,605 (GRCm39) missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119,155,252 (GRCm39) missense probably benign 0.26
R3871:Ccdc40 UTSW 11 119,155,107 (GRCm39) missense probably damaging 1.00
R4508:Ccdc40 UTSW 11 119,133,335 (GRCm39) missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119,122,358 (GRCm39) missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119,122,332 (GRCm39) missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119,144,447 (GRCm39) missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119,122,614 (GRCm39) missense probably benign
R5237:Ccdc40 UTSW 11 119,150,802 (GRCm39) missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119,128,753 (GRCm39) missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119,122,398 (GRCm39) missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119,136,906 (GRCm39) critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119,133,572 (GRCm39) missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119,144,229 (GRCm39) missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119,141,838 (GRCm39) missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119,133,898 (GRCm39) missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119,122,804 (GRCm39) missense probably benign
R6166:Ccdc40 UTSW 11 119,122,827 (GRCm39) missense probably benign
R6336:Ccdc40 UTSW 11 119,122,819 (GRCm39) missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119,133,560 (GRCm39) missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119,133,565 (GRCm39) missense possibly damaging 0.82
R7022:Ccdc40 UTSW 11 119,122,612 (GRCm39) missense possibly damaging 0.82
R7212:Ccdc40 UTSW 11 119,155,270 (GRCm39) missense probably damaging 0.99
R7472:Ccdc40 UTSW 11 119,153,974 (GRCm39) missense probably benign 0.30
R7522:Ccdc40 UTSW 11 119,123,047 (GRCm39) missense possibly damaging 0.73
R7888:Ccdc40 UTSW 11 119,119,967 (GRCm39) missense unknown
R8041:Ccdc40 UTSW 11 119,122,507 (GRCm39) missense possibly damaging 0.53
R8117:Ccdc40 UTSW 11 119,144,211 (GRCm39) missense probably benign 0.00
R8162:Ccdc40 UTSW 11 119,150,870 (GRCm39) critical splice donor site probably null
R8514:Ccdc40 UTSW 11 119,121,459 (GRCm39) missense unknown
R8725:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8727:Ccdc40 UTSW 11 119,155,323 (GRCm39) missense probably benign
R8799:Ccdc40 UTSW 11 119,155,292 (GRCm39) missense probably benign 0.00
R8877:Ccdc40 UTSW 11 119,153,992 (GRCm39) missense probably damaging 1.00
R9304:Ccdc40 UTSW 11 119,122,597 (GRCm39) missense probably benign 0.06
S24628:Ccdc40 UTSW 11 119,122,944 (GRCm39) missense possibly damaging 0.92
Z1176:Ccdc40 UTSW 11 119,142,834 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc40 UTSW 11 119,145,224 (GRCm39) missense probably benign 0.16
Z1177:Ccdc40 UTSW 11 119,128,933 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGTGCTGAATACTTGGTCC -3'
(R):5'- AACGCACAGGCTTCTCCTAG -3'

Sequencing Primer
(F):5'- GCTTGCTGAAGGAAGTCCATC -3'
(R):5'- ACAGGCTTCTCCTAGGGTGG -3'
Posted On 2014-11-11