Incidental Mutation 'R2370:Nlrp4f'
ID247508
Institutional Source Beutler Lab
Gene Symbol Nlrp4f
Ensembl Gene ENSMUSG00000032999
Gene NameNLR family, pyrin domain containing 4F
SynonymsNalp-kappa, Nalp4f, C330026N02Rik
MMRRC Submission 040350-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2370 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location65177111-65205977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65190846 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 659 (Y659C)
Ref Sequence ENSEMBL: ENSMUSP00000152418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037372] [ENSMUST00000220448] [ENSMUST00000221659] [ENSMUST00000222514] [ENSMUST00000222559] [ENSMUST00000223418]
Predicted Effect probably damaging
Transcript: ENSMUST00000037372
AA Change: Y659C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041908
Gene: ENSMUSG00000032999
AA Change: Y659C

DomainStartEndE-ValueType
PYRIN 6 88 1.44e-26 SMART
Pfam:NACHT 147 316 3.4e-39 PFAM
LRR 632 659 1.18e1 SMART
LRR 686 713 4.22e1 SMART
LRR 715 742 5.66e1 SMART
LRR 743 769 4.03e0 SMART
LRR 771 798 1.17e0 SMART
LRR 799 826 1.43e-1 SMART
LRR 828 855 1.03e-2 SMART
LRR 856 883 5.59e-4 SMART
LRR 885 912 2.91e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220448
Predicted Effect probably damaging
Transcript: ENSMUST00000221659
AA Change: Y659C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000222514
AA Change: Y659C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000222559
Predicted Effect probably benign
Transcript: ENSMUST00000223418
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abca13 A G 11: 9,256,185 T162A possibly damaging Het
Adamts9 T A 6: 92,860,203 D578V probably damaging Het
Atp6v1a T C 16: 44,107,040 T295A probably benign Het
Brinp1 A G 4: 68,762,947 S449P probably damaging Het
Ccdc40 A G 11: 119,263,117 T1072A probably benign Het
Chil4 C A 3: 106,214,300 E78* probably null Het
Cul7 A G 17: 46,661,641 Y1250C probably damaging Het
Dock3 T C 9: 106,952,355 D1120G probably damaging Het
Gfod1 A G 13: 43,201,145 M118T probably benign Het
Ints5 A G 19: 8,896,779 T701A probably benign Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Mast4 T A 13: 102,774,187 E457D probably damaging Het
Mettl4 T C 17: 94,733,148 D404G probably damaging Het
Mgat4a A G 1: 37,464,533 F58L probably damaging Het
Myh4 A G 11: 67,255,628 K1476E probably damaging Het
Myl7 T C 11: 5,896,684 E175G probably damaging Het
Myo18a A G 11: 77,777,770 E152G probably benign Het
Ncan G A 8: 70,112,813 T187I probably benign Het
Nfatc3 A G 8: 106,108,455 Y803C probably damaging Het
Noxred1 T C 12: 87,227,046 T74A probably benign Het
Ntrk2 A T 13: 59,054,434 M619L probably benign Het
Olfr1143 A T 2: 87,802,815 N142I probably benign Het
Orc4 A G 2: 48,933,099 V120A probably benign Het
Polq T A 16: 37,073,939 Y2037N probably damaging Het
Rimbp2 A G 5: 128,803,844 C160R probably damaging Het
Rps6ka4 T C 19: 6,830,100 S721G possibly damaging Het
Skap2 C T 6: 51,921,330 R140Q probably damaging Het
Srprb C T 9: 103,197,556 R838H probably damaging Het
Other mutations in Nlrp4f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Nlrp4f APN 13 65195543 nonsense probably null
IGL01676:Nlrp4f APN 13 65195119 missense possibly damaging 0.95
IGL01701:Nlrp4f APN 13 65199409 missense probably damaging 1.00
IGL01799:Nlrp4f APN 13 65187462 missense probably benign 0.03
IGL02084:Nlrp4f APN 13 65194171 nonsense probably null
IGL02234:Nlrp4f APN 13 65194488 missense probably damaging 1.00
IGL02481:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02483:Nlrp4f APN 13 65194734 missense probably benign 0.04
IGL02625:Nlrp4f APN 13 65199271 missense probably damaging 1.00
IGL02814:Nlrp4f APN 13 65185042 missense probably damaging 0.98
IGL03077:Nlrp4f APN 13 65194598 missense probably benign 0.10
IGL03111:Nlrp4f APN 13 65183002 missense probably damaging 1.00
IGL03175:Nlrp4f APN 13 65194596 missense probably damaging 1.00
IGL03324:Nlrp4f APN 13 65195228 missense possibly damaging 0.91
R0398:Nlrp4f UTSW 13 65194918 missense possibly damaging 0.79
R0477:Nlrp4f UTSW 13 65190906 missense probably benign 0.01
R0707:Nlrp4f UTSW 13 65194503 missense probably benign 0.42
R1052:Nlrp4f UTSW 13 65185083 missense possibly damaging 0.73
R1302:Nlrp4f UTSW 13 65194557 missense possibly damaging 0.77
R1460:Nlrp4f UTSW 13 65190268 missense probably benign 0.23
R1970:Nlrp4f UTSW 13 65194091 missense probably damaging 1.00
R2111:Nlrp4f UTSW 13 65199353 missense probably benign 0.11
R2272:Nlrp4f UTSW 13 65194408 missense probably benign 0.01
R2680:Nlrp4f UTSW 13 65194343 nonsense probably null
R3120:Nlrp4f UTSW 13 65194716 missense probably benign 0.13
R3737:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4035:Nlrp4f UTSW 13 65194007 missense probably benign 0.01
R4107:Nlrp4f UTSW 13 65183065 missense probably benign 0.01
R4422:Nlrp4f UTSW 13 65184962 critical splice donor site probably null
R4718:Nlrp4f UTSW 13 65194989 missense probably benign 0.01
R5652:Nlrp4f UTSW 13 65182989 missense probably benign 0.00
R5656:Nlrp4f UTSW 13 65190871 nonsense probably null
R5912:Nlrp4f UTSW 13 65194908 missense probably damaging 0.99
R5915:Nlrp4f UTSW 13 65187555 missense probably damaging 1.00
R5955:Nlrp4f UTSW 13 65195081 missense probably benign 0.15
R6683:Nlrp4f UTSW 13 65199195 missense probably benign 0.01
R6742:Nlrp4f UTSW 13 65187440 critical splice donor site probably null
R6750:Nlrp4f UTSW 13 65181654 nonsense probably null
R6751:Nlrp4f UTSW 13 65194429 missense probably damaging 0.99
R7110:Nlrp4f UTSW 13 65199346 missense probably damaging 0.96
R7143:Nlrp4f UTSW 13 65195306 missense probably damaging 1.00
R7143:Nlrp4f UTSW 13 65199352 missense possibly damaging 0.90
R7187:Nlrp4f UTSW 13 65195387 missense possibly damaging 0.47
R7230:Nlrp4f UTSW 13 65194901 missense probably benign 0.16
R7283:Nlrp4f UTSW 13 65195538 nonsense probably null
R7501:Nlrp4f UTSW 13 65194329 missense probably damaging 0.99
Z1088:Nlrp4f UTSW 13 65194302 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGCAGTAGACATTAGAAGTGTC -3'
(R):5'- AGAATTTGAAAGCTCCAGCAGG -3'

Sequencing Primer
(F):5'- GTGTCAAGACAGAAAGATTCCAC -3'
(R):5'- GATGTTTGTGAACCACCACG -3'
Posted On2014-11-11