Incidental Mutation 'R2370:Mettl4'
ID247513
Institutional Source Beutler Lab
Gene Symbol Mettl4
Ensembl Gene ENSMUSG00000055660
Gene Namemethyltransferase like 4
SynonymsHsT661, A730091E08Rik, 2410198H06Rik
MMRRC Submission 040350-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R2370 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location94727080-94749892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94733148 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 404 (D404G)
Ref Sequence ENSEMBL: ENSMUSP00000127142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171284]
Predicted Effect probably damaging
Transcript: ENSMUST00000171284
AA Change: D404G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127142
Gene: ENSMUSG00000055660
AA Change: D404G

DomainStartEndE-ValueType
Pfam:MT-A70 280 454 9.9e-43 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abca13 A G 11: 9,256,185 T162A possibly damaging Het
Adamts9 T A 6: 92,860,203 D578V probably damaging Het
Atp6v1a T C 16: 44,107,040 T295A probably benign Het
Brinp1 A G 4: 68,762,947 S449P probably damaging Het
Ccdc40 A G 11: 119,263,117 T1072A probably benign Het
Chil4 C A 3: 106,214,300 E78* probably null Het
Cul7 A G 17: 46,661,641 Y1250C probably damaging Het
Dock3 T C 9: 106,952,355 D1120G probably damaging Het
Gfod1 A G 13: 43,201,145 M118T probably benign Het
Ints5 A G 19: 8,896,779 T701A probably benign Het
Map4k2 G T 19: 6,341,928 E91* probably null Het
Mast4 T A 13: 102,774,187 E457D probably damaging Het
Mgat4a A G 1: 37,464,533 F58L probably damaging Het
Myh4 A G 11: 67,255,628 K1476E probably damaging Het
Myl7 T C 11: 5,896,684 E175G probably damaging Het
Myo18a A G 11: 77,777,770 E152G probably benign Het
Ncan G A 8: 70,112,813 T187I probably benign Het
Nfatc3 A G 8: 106,108,455 Y803C probably damaging Het
Nlrp4f T C 13: 65,190,846 Y659C probably damaging Het
Noxred1 T C 12: 87,227,046 T74A probably benign Het
Ntrk2 A T 13: 59,054,434 M619L probably benign Het
Olfr1143 A T 2: 87,802,815 N142I probably benign Het
Orc4 A G 2: 48,933,099 V120A probably benign Het
Polq T A 16: 37,073,939 Y2037N probably damaging Het
Rimbp2 A G 5: 128,803,844 C160R probably damaging Het
Rps6ka4 T C 19: 6,830,100 S721G possibly damaging Het
Skap2 C T 6: 51,921,330 R140Q probably damaging Het
Srprb C T 9: 103,197,556 R838H probably damaging Het
Other mutations in Mettl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03376:Mettl4 APN 17 94735371 missense probably damaging 1.00
R1938:Mettl4 UTSW 17 94747857 missense possibly damaging 0.76
R2172:Mettl4 UTSW 17 94733163 missense probably benign
R3621:Mettl4 UTSW 17 94735508 missense probably damaging 1.00
R3913:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R4155:Mettl4 UTSW 17 94740575 missense probably benign
R4536:Mettl4 UTSW 17 94735505 missense possibly damaging 0.79
R4946:Mettl4 UTSW 17 94740532 missense probably benign 0.06
R5263:Mettl4 UTSW 17 94740509 nonsense probably null
R5397:Mettl4 UTSW 17 94727277 nonsense probably null
R6242:Mettl4 UTSW 17 94735374 missense probably damaging 1.00
R6508:Mettl4 UTSW 17 94743945 missense probably damaging 0.98
R7069:Mettl4 UTSW 17 94733633 missense probably damaging 0.98
R7941:Mettl4 UTSW 17 94733194 splice site probably null
R8088:Mettl4 UTSW 17 94735367 missense probably damaging 1.00
R8373:Mettl4 UTSW 17 94733649 missense probably damaging 1.00
Z1176:Mettl4 UTSW 17 94733563 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTGATATAAACTAACCTGTGCTC -3'
(R):5'- ATCTGAAAGTGACCTAGAGCTG -3'

Sequencing Primer
(F):5'- AAACTAACCTGTGCTCTATTTCAC -3'
(R):5'- GACCTAGAGCTGAAAAGTATGTTAC -3'
Posted On2014-11-11