Mutagenetix > Incidental Mutation

Incidental Mutation 'R2371:Adamts18'

247530

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 18

Synonyms

E130314N14Rik

MMRRC Submission

040351-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R2371 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114423758-114575370 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114431893 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 1105 (E1105V)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably benign
Transcript: ENSMUST00000093113
AA Change: E1105V

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: E1105V

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
Colec10	A	G	15: 54,325,796 (GRCm39)	I209V	possibly damaging	Het
Cttnbp2	T	G	6: 18,380,603 (GRCm39)	S1422R	possibly damaging	Het
Dcst1	C	G	3: 89,265,949 (GRCm39)	V179L	possibly damaging	Het
Fbxw9	T	C	8: 85,788,658 (GRCm39)	Y165H	probably benign	Het
Fgl2	A	T	5: 21,580,816 (GRCm39)	Y386F	probably damaging	Het
Gabrb2	A	G	11: 42,482,691 (GRCm39)	Y183C	probably damaging	Het
Hlcs	A	G	16: 94,068,926 (GRCm39)	L245P	probably damaging	Het
Hormad1	T	A	3: 95,482,910 (GRCm39)	I132K	probably benign	Het
Itga8	A	T	2: 12,258,277 (GRCm39)	D262E	probably damaging	Het
Jhy	G	A	9: 40,828,778 (GRCm39)	T376I	probably benign	Het
Kidins220	T	C	12: 25,107,323 (GRCm39)	L1592P	probably damaging	Het
Kif3b	T	C	2: 153,164,743 (GRCm39)	I587T	possibly damaging	Het
Lrrc7	A	G	3: 157,866,697 (GRCm39)	Y1015H	probably damaging	Het
Lvrn	T	G	18: 47,011,230 (GRCm39)		probably null	Het
Mapkbp1	C	A	2: 119,841,261 (GRCm39)	Q83K	probably damaging	Het
Or2g25	T	C	17: 37,971,044 (GRCm39)	Y60C	probably damaging	Het
Or5b12	A	T	19: 12,897,031 (GRCm39)	I214N	probably benign	Het
Pigc	T	C	1: 161,798,579 (GRCm39)	V187A	possibly damaging	Het
Ros1	A	T	10: 52,039,991 (GRCm39)	H333Q	possibly damaging	Het
Rreb1	T	C	13: 38,100,513 (GRCm39)	F215L	probably benign	Het
Rtcb	C	T	10: 85,779,697 (GRCm39)	M324I	probably benign	Het
Senp2	A	G	16: 21,837,125 (GRCm39)	I125V	possibly damaging	Het
Shroom3	A	G	5: 92,928,729 (GRCm39)	K95E	probably damaging	Het
Wrnip1	C	T	13: 32,986,410 (GRCm39)	P64S	probably benign	Het
Zbtb24	C	T	10: 41,327,264 (GRCm39)	A50V	probably damaging	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	114,501,575 (GRCm39)	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	114,490,931 (GRCm39)	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	114,571,741 (GRCm39)	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	114,469,728 (GRCm39)	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	114,439,826 (GRCm39)	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	114,425,704 (GRCm39)	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	114,440,976 (GRCm39)	splice site	probably benign
IGL03188:Adamts18	APN	8	114,425,656 (GRCm39)	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	114,490,929 (GRCm39)	nonsense	probably null
G1patch:Adamts18	UTSW	8	114,469,833 (GRCm39)	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	114,501,585 (GRCm39)	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	114,469,749 (GRCm39)	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	114,440,990 (GRCm39)	nonsense	probably null
R0480:Adamts18	UTSW	8	114,465,450 (GRCm39)	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	114,465,401 (GRCm39)	splice site	probably null
R0924:Adamts18	UTSW	8	114,432,028 (GRCm39)	splice site	probably null
R0930:Adamts18	UTSW	8	114,432,028 (GRCm39)	splice site	probably null
R1333:Adamts18	UTSW	8	114,431,805 (GRCm39)	splice site	probably benign
R1441:Adamts18	UTSW	8	114,481,194 (GRCm39)	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	114,501,965 (GRCm39)	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	114,571,635 (GRCm39)	missense	possibly damaging	0.58
R3148:Adamts18	UTSW	8	114,465,490 (GRCm39)	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	114,504,443 (GRCm39)	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	114,464,212 (GRCm39)	nonsense	probably null
R4486:Adamts18	UTSW	8	114,439,825 (GRCm39)	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	114,464,245 (GRCm39)	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4626:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4627:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4628:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4629:Adamts18	UTSW	8	114,499,800 (GRCm39)	nonsense	probably null
R4710:Adamts18	UTSW	8	114,433,558 (GRCm39)	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	114,463,357 (GRCm39)	nonsense	probably null
R4973:Adamts18	UTSW	8	114,463,357 (GRCm39)	nonsense	probably null
R4976:Adamts18	UTSW	8	114,425,642 (GRCm39)	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	114,425,642 (GRCm39)	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	114,501,902 (GRCm39)	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	114,425,606 (GRCm39)	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	114,501,992 (GRCm39)	nonsense	probably null
R5868:Adamts18	UTSW	8	114,504,380 (GRCm39)	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	114,499,709 (GRCm39)	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	114,436,251 (GRCm39)	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	114,504,380 (GRCm39)	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	114,433,606 (GRCm39)	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	114,501,911 (GRCm39)	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	114,469,833 (GRCm39)	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	114,501,922 (GRCm39)	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	114,501,896 (GRCm39)	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	114,436,277 (GRCm39)	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	114,504,362 (GRCm39)	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	114,439,855 (GRCm39)	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	114,463,566 (GRCm39)	splice site	probably null
R7860:Adamts18	UTSW	8	114,501,908 (GRCm39)	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	114,493,760 (GRCm39)	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	114,481,227 (GRCm39)	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	114,493,795 (GRCm39)	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	114,433,624 (GRCm39)	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	114,463,510 (GRCm39)	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	114,430,030 (GRCm39)	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	114,501,910 (GRCm39)	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	114,490,942 (GRCm39)	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	114,504,570 (GRCm39)	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	114,502,072 (GRCm39)	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	114,469,800 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- CTCTACACAGTGGGACAACG -3'
(R):5'- GGAGGGACTTGACATGTCATTG -3'

Sequencing Primer
(F):5'- GGTTGATGGGCTAAGGACAATACC -3'
(R):5'- GGACTTGACATGTCATTGACACTG -3'

Posted On

2014-11-11