Incidental Mutation 'R0288:Dennd1c'
ID24756
Institutional Source Beutler Lab
Gene Symbol Dennd1c
Ensembl Gene ENSMUSG00000002668
Gene NameDENN/MADD domain containing 1C
Synonyms4432409M07Rik
MMRRC Submission 038507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0288 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57066056-57078510 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 57076870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011623] [ENSMUST00000071135]
Predicted Effect probably null
Transcript: ENSMUST00000011623
SMART Domains Protein: ENSMUSP00000011623
Gene: ENSMUSG00000002668

DomainStartEndE-ValueType
uDENN 9 89 1.18e-22 SMART
DENN 90 293 3.95e-74 SMART
low complexity region 312 318 N/A INTRINSIC
dDENN 324 391 2.39e-18 SMART
low complexity region 560 579 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071135
SMART Domains Protein: ENSMUSP00000071135
Gene: ENSMUSG00000062591

DomainStartEndE-ValueType
Tubulin 47 244 4.45e-67 SMART
Tubulin_C 246 383 5.5e-49 SMART
low complexity region 428 444 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.1%
  • 20x: 89.7%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1C, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,039,940 E413G possibly damaging Het
Amigo2 G T 15: 97,245,679 N287K probably damaging Het
Ankle2 T A 5: 110,236,390 I260K probably damaging Het
Apob C T 12: 7,990,779 R635* probably null Het
Camkv A G 9: 107,946,356 Y153C probably damaging Het
Capn9 A G 8: 124,600,491 probably benign Het
Ces2c A G 8: 104,849,744 I130V probably benign Het
Cfap44 T A 16: 44,415,894 probably benign Het
Cfhr3 A G 1: 139,597,687 noncoding transcript Het
Chmp1a G T 8: 123,208,006 D70E probably damaging Het
Coil G A 11: 88,981,868 G352R probably damaging Het
Colq T C 14: 31,543,992 E188G possibly damaging Het
Cyfip2 A G 11: 46,253,972 F685S possibly damaging Het
Cyp4f39 A G 17: 32,492,436 N519S probably benign Het
Dnah9 A T 11: 66,025,134 probably null Het
Dnmbp T C 19: 43,902,459 T290A possibly damaging Het
Dsc2 T C 18: 20,033,120 D818G probably damaging Het
Gnptab G A 10: 88,433,105 V557I probably benign Het
Hdac4 A T 1: 91,971,006 H675Q probably damaging Het
Kcnk3 T C 5: 30,588,420 M35T probably benign Het
Kif1b A T 4: 149,199,338 I1290N probably damaging Het
Klhl14 G A 18: 21,565,563 R398W probably damaging Het
Marveld1 T C 19: 42,147,826 F60L probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Ndst3 A T 3: 123,672,194 V43D probably benign Het
Nhsl1 A G 10: 18,524,046 D306G probably damaging Het
Nlrp2 A G 7: 5,328,545 V284A probably benign Het
Pcdhb15 T C 18: 37,475,398 V561A probably damaging Het
Pdcl2 T C 5: 76,312,497 I177V possibly damaging Het
Pkd1l3 G A 8: 109,646,499 probably null Het
Pla2g6 A C 15: 79,286,906 probably benign Het
Plekhj1 A T 10: 80,796,610 I122N probably damaging Het
Pmel T C 10: 128,714,306 I70T probably benign Het
Psip1 T C 4: 83,464,959 D273G probably damaging Het
Rictor A G 15: 6,786,540 I1098V probably benign Het
Rif1 T C 2: 52,110,013 S1160P probably damaging Het
Rsbn1l T C 5: 20,920,040 I255V probably damaging Het
Slc15a5 A G 6: 138,017,916 probably benign Het
Slc29a1 G A 17: 45,589,804 R111W probably damaging Het
Slc36a1 G A 11: 55,219,087 A74T probably damaging Het
Slc5a7 A T 17: 54,293,018 Y122* probably null Het
Slc6a3 G T 13: 73,560,928 G324W probably damaging Het
Sltm T C 9: 70,579,351 S433P probably damaging Het
Spta1 T C 1: 174,243,179 S2190P probably damaging Het
Sry A T Y: 2,662,818 F281I unknown Het
Stk32a T A 18: 43,304,995 probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tbl3 G A 17: 24,701,807 H612Y probably damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Top2a A G 11: 99,016,423 probably benign Het
Usp9y A T Y: 1,333,606 probably benign Het
Vldlr G A 19: 27,240,651 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vmn2r28 A G 7: 5,488,021 L409P probably damaging Het
Vps13c T C 9: 67,927,366 V1659A probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp280d A T 9: 72,331,339 K646* probably null Het
Zfp36 A G 7: 28,378,241 S81P probably benign Het
Zfp618 A T 4: 63,132,934 T651S possibly damaging Het
Other mutations in Dennd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Dennd1c APN 17 57066839 missense probably damaging 0.99
IGL02729:Dennd1c APN 17 57066637 missense probably benign 0.34
IGL03185:Dennd1c APN 17 57066803 missense probably benign 0.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0067:Dennd1c UTSW 17 57075465 missense probably damaging 1.00
R0380:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0381:Dennd1c UTSW 17 57073822 missense probably damaging 1.00
R0389:Dennd1c UTSW 17 57067649 missense probably benign 0.02
R1528:Dennd1c UTSW 17 57066935 missense probably benign
R1892:Dennd1c UTSW 17 57067083 missense probably benign 0.00
R1936:Dennd1c UTSW 17 57073889 splice site probably benign
R2216:Dennd1c UTSW 17 57074492 critical splice donor site probably null
R3021:Dennd1c UTSW 17 57074180 critical splice acceptor site probably null
R3160:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R3162:Dennd1c UTSW 17 57066562 missense possibly damaging 0.87
R4133:Dennd1c UTSW 17 57076980 missense possibly damaging 0.53
R4831:Dennd1c UTSW 17 57066428 nonsense probably null
R4987:Dennd1c UTSW 17 57073852 missense probably damaging 0.98
R5417:Dennd1c UTSW 17 57066755 frame shift probably null
R5418:Dennd1c UTSW 17 57066755 frame shift probably null
R6241:Dennd1c UTSW 17 57066272 missense probably benign 0.00
R6259:Dennd1c UTSW 17 57067104 missense probably damaging 1.00
R6722:Dennd1c UTSW 17 57066802 missense probably benign
R7099:Dennd1c UTSW 17 57067915 critical splice donor site probably null
R7491:Dennd1c UTSW 17 57072379 missense probably damaging 1.00
R7595:Dennd1c UTSW 17 57071633 missense probably damaging 1.00
Z1177:Dennd1c UTSW 17 57074330 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTACACCAGTCCTCTTGGCCTTG -3'
(R):5'- TTCAGCAGCATTCACACCTGGCTC -3'

Sequencing Primer
(F):5'- GCCTTGCCCCTCAGTTCAG -3'
(R):5'- CCTAGTTACACACGAGACAGGG -3'
Posted On2013-04-16